Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626399_at:

>probe:Drosophila_2:1626399_at:192:721; Interrogation_Position=117; Antisense; TTGCCATGGATGACTTTGATTTCAG
>probe:Drosophila_2:1626399_at:627:723; Interrogation_Position=132; Antisense; TTGATTTCAGTAGTCCACCTCCGGA
>probe:Drosophila_2:1626399_at:724:129; Interrogation_Position=148; Antisense; ACCTCCGGAGGTACGAACAGTTCAT
>probe:Drosophila_2:1626399_at:404:93; Interrogation_Position=166; Antisense; AGTTCATACCCACACGCTGAATGAT
>probe:Drosophila_2:1626399_at:246:653; Interrogation_Position=198; Antisense; TCAAGGATTGTGAGGCGGCCTTCGC
>probe:Drosophila_2:1626399_at:366:311; Interrogation_Position=242; Antisense; GCCAAGGTCATTCCGATCAAGTTAT
>probe:Drosophila_2:1626399_at:96:691; Interrogation_Position=264; Antisense; TATTGAGAGATTGCCTGCGAGCCGT
>probe:Drosophila_2:1626399_at:436:449; Interrogation_Position=348; Antisense; GATCCGGCGAGCTTTATCTCAGTGA
>probe:Drosophila_2:1626399_at:627:513; Interrogation_Position=369; Antisense; GTGATTTCCTATACATCATGTCGAA
>probe:Drosophila_2:1626399_at:646:91; Interrogation_Position=424; Antisense; AGTTATCCTCGCTTTCAAAGTCTTC
>probe:Drosophila_2:1626399_at:96:99; Interrogation_Position=454; Antisense; AGATGGATCTGGCTTTATACACGAG
>probe:Drosophila_2:1626399_at:431:231; Interrogation_Position=541; Antisense; AATGATACGTGATGCCGACGCCAAC
>probe:Drosophila_2:1626399_at:621:147; Interrogation_Position=582; Antisense; ACTACGTTCGCTTTGTGACCATGAT
>probe:Drosophila_2:1626399_at:348:441; Interrogation_Position=607; Antisense; GATGGAGACGTAACACTCTCTTTGA

Paste this into a BLAST search page for me
TTGCCATGGATGACTTTGATTTCAGTTGATTTCAGTAGTCCACCTCCGGAACCTCCGGAGGTACGAACAGTTCATAGTTCATACCCACACGCTGAATGATTCAAGGATTGTGAGGCGGCCTTCGCGCCAAGGTCATTCCGATCAAGTTATTATTGAGAGATTGCCTGCGAGCCGTGATCCGGCGAGCTTTATCTCAGTGAGTGATTTCCTATACATCATGTCGAAAGTTATCCTCGCTTTCAAAGTCTTCAGATGGATCTGGCTTTATACACGAGAATGATACGTGATGCCGACGCCAACACTACGTTCGCTTTGTGACCATGATGATGGAGACGTAACACTCTCTTTGA

Full Affymetrix probeset data:

Annotations for 1626399_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime