Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626400_at:

>probe:Drosophila_2:1626400_at:287:633; Interrogation_Position=1887; Antisense; TCCGCTCAAGGATTACGCCGTAAAC
>probe:Drosophila_2:1626400_at:336:365; Interrogation_Position=1964; Antisense; GAATACCTTGCTTTTGGAGCAGCTG
>probe:Drosophila_2:1626400_at:405:529; Interrogation_Position=1996; Antisense; GGGATCTCCAGTGCTGCTTGGCTAC
>probe:Drosophila_2:1626400_at:142:607; Interrogation_Position=2036; Antisense; TGACAGTGCCGGGAAACCTGGAACT
>probe:Drosophila_2:1626400_at:353:91; Interrogation_Position=2111; Antisense; AGTTTGAATTGGCTGGTCCACCGCA
>probe:Drosophila_2:1626400_at:239:523; Interrogation_Position=2139; Antisense; GGGCCTGTATATAAGACCGCTGGAT
>probe:Drosophila_2:1626400_at:715:77; Interrogation_Position=2177; Antisense; AGGATTGGTCCTTTATACGAACGAT
>probe:Drosophila_2:1626400_at:416:685; Interrogation_Position=2190; Antisense; TATACGAACGATGCTGGACCAGCCA
>probe:Drosophila_2:1626400_at:402:243; Interrogation_Position=2238; Antisense; AATATACTTCTCTTACGGCGTGGAT
>probe:Drosophila_2:1626400_at:442:329; Interrogation_Position=2255; Antisense; GCGTGGATAGCTCCCCATTCAAATT
>probe:Drosophila_2:1626400_at:568:407; Interrogation_Position=2318; Antisense; GACCGATTTTCGAACTGGGCGTTGT
>probe:Drosophila_2:1626400_at:119:525; Interrogation_Position=2372; Antisense; GGGATGAGACAACCCTTCGGTTCAT
>probe:Drosophila_2:1626400_at:188:541; Interrogation_Position=2390; Antisense; GGTTCATAGCTGATTTGCCGGACTT
>probe:Drosophila_2:1626400_at:677:227; Interrogation_Position=2429; Antisense; AATGGCCATCTCTGTTTATGCGTTA

Paste this into a BLAST search page for me
TCCGCTCAAGGATTACGCCGTAAACGAATACCTTGCTTTTGGAGCAGCTGGGGATCTCCAGTGCTGCTTGGCTACTGACAGTGCCGGGAAACCTGGAACTAGTTTGAATTGGCTGGTCCACCGCAGGGCCTGTATATAAGACCGCTGGATAGGATTGGTCCTTTATACGAACGATTATACGAACGATGCTGGACCAGCCAAATATACTTCTCTTACGGCGTGGATGCGTGGATAGCTCCCCATTCAAATTGACCGATTTTCGAACTGGGCGTTGTGGGATGAGACAACCCTTCGGTTCATGGTTCATAGCTGATTTGCCGGACTTAATGGCCATCTCTGTTTATGCGTTA

Full Affymetrix probeset data:

Annotations for 1626400_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime