FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626401_at:

>probe:Drosophila_2:1626401_at:205:255; Interrogation_Position=1103; Antisense; CAAAGCCATGACCTACTTGAACCAG
>probe:Drosophila_2:1626401_at:470:175; Interrogation_Position=1138; Antisense; AAACCCTGAGGCTCTACACACTGGT
>probe:Drosophila_2:1626401_at:171:371; Interrogation_Position=1178; Antisense; GAAGGCCCTCAACGACTACGTGGTG
>probe:Drosophila_2:1626401_at:117:319; Interrogation_Position=1202; Antisense; GCCGGGCCATGAAAAGCTTGTGATT
>probe:Drosophila_2:1626401_at:200:673; Interrogation_Position=1263; Antisense; TACCACCGCGACGAGGATCTTTATC
>probe:Drosophila_2:1626401_at:322:425; Interrogation_Position=1296; Antisense; GAGACCTTTGATCCGGAGCGCTTCT
>probe:Drosophila_2:1626401_at:108:397; Interrogation_Position=1405; Antisense; GACAAATGCAGGCTCGCATCGGTTT
>probe:Drosophila_2:1626401_at:524:345; Interrogation_Position=1420; Antisense; GCATCGGTTTGGCTCAGATCATCAG
>probe:Drosophila_2:1626401_at:616:453; Interrogation_Position=1436; Antisense; GATCATCAGCCGGTTCAGGGTATCC
>probe:Drosophila_2:1626401_at:9:267; Interrogation_Position=1451; Antisense; CAGGGTATCCGTCTGCGATACGACA
>probe:Drosophila_2:1626401_at:262:373; Interrogation_Position=1487; Antisense; GAAGTATAGTCCCATGTCCATAGTT
>probe:Drosophila_2:1626401_at:41:63; Interrogation_Position=1500; Antisense; ATGTCCATAGTTTTGGGCACCGTTG
>probe:Drosophila_2:1626401_at:182:433; Interrogation_Position=1540; Antisense; GAGTGGAACGCATCTAACCTCCATA
>probe:Drosophila_2:1626401_at:80:629; Interrogation_Position=1559; Antisense; TCCATATTCGTTGCTCCCATGTATA

Paste this into a BLAST search page for me
CAAAGCCATGACCTACTTGAACCAGAAACCCTGAGGCTCTACACACTGGTGAAGGCCCTCAACGACTACGTGGTGGCCGGGCCATGAAAAGCTTGTGATTTACCACCGCGACGAGGATCTTTATCGAGACCTTTGATCCGGAGCGCTTCTGACAAATGCAGGCTCGCATCGGTTTGCATCGGTTTGGCTCAGATCATCAGGATCATCAGCCGGTTCAGGGTATCCCAGGGTATCCGTCTGCGATACGACAGAAGTATAGTCCCATGTCCATAGTTATGTCCATAGTTTTGGGCACCGTTGGAGTGGAACGCATCTAACCTCCATATCCATATTCGTTGCTCCCATGTATA

Full Affymetrix probeset data:

Annotations for 1626401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720