FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626402_at:

>probe:Drosophila_2:1626402_at:170:685; Interrogation_Position=111; Antisense; TATCAAGTATGACCTGCACGTGCTA
>probe:Drosophila_2:1626402_at:460:617; Interrogation_Position=125; Antisense; TGCACGTGCTAACCCAGCTGGAATA
>probe:Drosophila_2:1626402_at:99:409; Interrogation_Position=240; Antisense; GACGATCGATGAGACGGCAACCACT
>probe:Drosophila_2:1626402_at:667:283; Interrogation_Position=300; Antisense; CTGCGTGTCCTCCACAGAGGTAAAT
>probe:Drosophila_2:1626402_at:317:537; Interrogation_Position=318; Antisense; GGTAAATCCCGAACACGACTTCTAT
>probe:Drosophila_2:1626402_at:327:353; Interrogation_Position=350; Antisense; GCACCTGCAGACAACTTTTGGCTGG
>probe:Drosophila_2:1626402_at:527:727; Interrogation_Position=367; Antisense; TTGGCTGGCCAAGTCTATGAGCTCA
>probe:Drosophila_2:1626402_at:687:417; Interrogation_Position=385; Antisense; GAGCTCAGTTTGCTATTTTCGTCCA
>probe:Drosophila_2:1626402_at:578:701; Interrogation_Position=400; Antisense; TTTTCGTCCACATTGTCAGACCGAT
>probe:Drosophila_2:1626402_at:152:139; Interrogation_Position=449; Antisense; ACGTGGATCCTGTGGCCAATGAGAC
>probe:Drosophila_2:1626402_at:329:705; Interrogation_Position=49; Antisense; TTAGGATTAGCCACACCCAATTCGA
>probe:Drosophila_2:1626402_at:494:305; Interrogation_Position=520; Antisense; CCTTGTATGTTCACCGGACTTAGCA
>probe:Drosophila_2:1626402_at:510:665; Interrogation_Position=76; Antisense; TACAATCATTATCGCCTGCCGACGG
>probe:Drosophila_2:1626402_at:439:407; Interrogation_Position=96; Antisense; GACGGCACTTCGACCTATCAAGTAT

Paste this into a BLAST search page for me
TATCAAGTATGACCTGCACGTGCTATGCACGTGCTAACCCAGCTGGAATAGACGATCGATGAGACGGCAACCACTCTGCGTGTCCTCCACAGAGGTAAATGGTAAATCCCGAACACGACTTCTATGCACCTGCAGACAACTTTTGGCTGGTTGGCTGGCCAAGTCTATGAGCTCAGAGCTCAGTTTGCTATTTTCGTCCATTTTCGTCCACATTGTCAGACCGATACGTGGATCCTGTGGCCAATGAGACTTAGGATTAGCCACACCCAATTCGACCTTGTATGTTCACCGGACTTAGCATACAATCATTATCGCCTGCCGACGGGACGGCACTTCGACCTATCAAGTAT

Full Affymetrix probeset data:

Annotations for 1626402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720