Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626404_a_at:

>probe:Drosophila_2:1626404_a_at:576:619; Interrogation_Position=227; Antisense; TGCTCCTTGCTCTCAACTAGTAATA
>probe:Drosophila_2:1626404_a_at:513:387; Interrogation_Position=264; Antisense; GAACAATGACGACAGCTCAGCACCA
>probe:Drosophila_2:1626404_a_at:71:113; Interrogation_Position=282; Antisense; AGCACCAACACTACACCGTCGAGGT
>probe:Drosophila_2:1626404_a_at:439:711; Interrogation_Position=320; Antisense; TTCACCATCCACAGTCGGTACATTA
>probe:Drosophila_2:1626404_a_at:123:539; Interrogation_Position=336; Antisense; GGTACATTAATCTACGGCCCATAGG
>probe:Drosophila_2:1626404_a_at:524:321; Interrogation_Position=352; Antisense; GCCCATAGGATCAGGTGCCCAAGGA
>probe:Drosophila_2:1626404_a_at:208:623; Interrogation_Position=367; Antisense; TGCCCAAGGAATAGTATGCGCCGCT
>probe:Drosophila_2:1626404_a_at:87:683; Interrogation_Position=381; Antisense; TATGCGCCGCTTACGATACTATCAC
>probe:Drosophila_2:1626404_a_at:704:685; Interrogation_Position=400; Antisense; TATCACCCAGCAAAATGTGGCGATT
>probe:Drosophila_2:1626404_a_at:251:389; Interrogation_Position=427; Antisense; GAAACTATCTCGACCATTCCAAAAT
>probe:Drosophila_2:1626404_a_at:678:181; Interrogation_Position=447; Antisense; AAAATGTAACCCATGCCAAGCGAGC
>probe:Drosophila_2:1626404_a_at:325:3; Interrogation_Position=580; Antisense; ATTGGCTTACTTAATGCTTTTACGC
>probe:Drosophila_2:1626404_a_at:144:341; Interrogation_Position=595; Antisense; GCTTTTACGCCGCAAAGGAACTTGG
>probe:Drosophila_2:1626404_a_at:326:443; Interrogation_Position=631; Antisense; GATGTCTACCTGGTCATGGAGCTGA

Paste this into a BLAST search page for me
TGCTCCTTGCTCTCAACTAGTAATAGAACAATGACGACAGCTCAGCACCAAGCACCAACACTACACCGTCGAGGTTTCACCATCCACAGTCGGTACATTAGGTACATTAATCTACGGCCCATAGGGCCCATAGGATCAGGTGCCCAAGGATGCCCAAGGAATAGTATGCGCCGCTTATGCGCCGCTTACGATACTATCACTATCACCCAGCAAAATGTGGCGATTGAAACTATCTCGACCATTCCAAAATAAAATGTAACCCATGCCAAGCGAGCATTGGCTTACTTAATGCTTTTACGCGCTTTTACGCCGCAAAGGAACTTGGGATGTCTACCTGGTCATGGAGCTGA

Full Affymetrix probeset data:

Annotations for 1626404_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime