FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626405_at:

>probe:Drosophila_2:1626405_at:83:487; Interrogation_Position=1572; Antisense; GTAGAATCCCACAACCAGAGCGAAC
>probe:Drosophila_2:1626405_at:294:415; Interrogation_Position=1589; Antisense; GAGCGAACCCCAATTGGATGGAGTT
>probe:Drosophila_2:1626405_at:251:551; Interrogation_Position=1608; Antisense; GGAGTTGTCCCAGGAAACTGTTGAT
>probe:Drosophila_2:1626405_at:527:193; Interrogation_Position=1623; Antisense; AACTGTTGATTTGCTTACCGTGTAA
>probe:Drosophila_2:1626405_at:210:521; Interrogation_Position=1672; Antisense; GTGGAAACGCACATCAAATATTGTT
>probe:Drosophila_2:1626405_at:635:673; Interrogation_Position=1692; Antisense; TTGTTTTTAGACCAATGCCATTGTG
>probe:Drosophila_2:1626405_at:3:371; Interrogation_Position=1716; Antisense; GAATGTCATTCGTTAAAGGCCAATT
>probe:Drosophila_2:1626405_at:560:167; Interrogation_Position=1730; Antisense; AAAGGCCAATTGAGACTGACTGAAT
>probe:Drosophila_2:1626405_at:513:97; Interrogation_Position=1797; Antisense; AGATCGGATGGAAGCCTCCAGCGCT
>probe:Drosophila_2:1626405_at:698:311; Interrogation_Position=1870; Antisense; GCCAAATGAATTTAAGCGACAGCGC
>probe:Drosophila_2:1626405_at:500:325; Interrogation_Position=1885; Antisense; GCGACAGCGCAAACATTGTTAGCTA
>probe:Drosophila_2:1626405_at:181:135; Interrogation_Position=1934; Antisense; ACGCAAATTGCAATTGCCCAATCAA
>probe:Drosophila_2:1626405_at:384:93; Interrogation_Position=1959; Antisense; AGTTGGTAACTGTAACTGTCTACAA
>probe:Drosophila_2:1626405_at:273:483; Interrogation_Position=2088; Antisense; GTGAAAACCCCGAGGCAAACTATAT

Paste this into a BLAST search page for me
GTAGAATCCCACAACCAGAGCGAACGAGCGAACCCCAATTGGATGGAGTTGGAGTTGTCCCAGGAAACTGTTGATAACTGTTGATTTGCTTACCGTGTAAGTGGAAACGCACATCAAATATTGTTTTGTTTTTAGACCAATGCCATTGTGGAATGTCATTCGTTAAAGGCCAATTAAAGGCCAATTGAGACTGACTGAATAGATCGGATGGAAGCCTCCAGCGCTGCCAAATGAATTTAAGCGACAGCGCGCGACAGCGCAAACATTGTTAGCTAACGCAAATTGCAATTGCCCAATCAAAGTTGGTAACTGTAACTGTCTACAAGTGAAAACCCCGAGGCAAACTATAT

Full Affymetrix probeset data:

Annotations for 1626405_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720