Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626407_at:

>probe:Drosophila_2:1626407_at:177:387; Interrogation_Position=255; Antisense; GAACAATTTCCCGAGATTTCCATGA
>probe:Drosophila_2:1626407_at:178:389; Interrogation_Position=278; Antisense; GAAACATCAGATCGAGGCCGTGCCC
>probe:Drosophila_2:1626407_at:284:155; Interrogation_Position=303; Antisense; ACAGTCATATTCTTCGCCAAGGGCT
>probe:Drosophila_2:1626407_at:651:441; Interrogation_Position=345; Antisense; GATGGTGTAGACATCGCCGCCATAA
>probe:Drosophila_2:1626407_at:266:169; Interrogation_Position=443; Antisense; AAAGGCCCTAATCAATACAGCTCCG
>probe:Drosophila_2:1626407_at:525:155; Interrogation_Position=459; Antisense; ACAGCTCCGCTGATGATATTCATGA
>probe:Drosophila_2:1626407_at:387:253; Interrogation_Position=518; Antisense; CAAGCAGCTCATCGGCATTGTGAAC
>probe:Drosophila_2:1626407_at:32:203; Interrogation_Position=545; Antisense; AACCAACTTGCCGTACGAGACATTT
>probe:Drosophila_2:1626407_at:408:149; Interrogation_Position=564; Antisense; ACATTTGACATCCTCGGCGACGAAG
>probe:Drosophila_2:1626407_at:7:495; Interrogation_Position=595; Antisense; GTCAAGGCCTGAAAACCTACTCCGA
>probe:Drosophila_2:1626407_at:619:147; Interrogation_Position=627; Antisense; ACATATCCCCAGGTTTACGTCAAGG
>probe:Drosophila_2:1626407_at:605:219; Interrogation_Position=648; Antisense; AAGGGTGAACTTATCGGCGGACTCG
>probe:Drosophila_2:1626407_at:347:387; Interrogation_Position=695; Antisense; GAACAATGAGCTCGAGTCCACGCTA
>probe:Drosophila_2:1626407_at:110:339; Interrogation_Position=716; Antisense; GCTAAAGGGCTAATTCCATCGGATT

Paste this into a BLAST search page for me
GAACAATTTCCCGAGATTTCCATGAGAAACATCAGATCGAGGCCGTGCCCACAGTCATATTCTTCGCCAAGGGCTGATGGTGTAGACATCGCCGCCATAAAAAGGCCCTAATCAATACAGCTCCGACAGCTCCGCTGATGATATTCATGACAAGCAGCTCATCGGCATTGTGAACAACCAACTTGCCGTACGAGACATTTACATTTGACATCCTCGGCGACGAAGGTCAAGGCCTGAAAACCTACTCCGAACATATCCCCAGGTTTACGTCAAGGAAGGGTGAACTTATCGGCGGACTCGGAACAATGAGCTCGAGTCCACGCTAGCTAAAGGGCTAATTCCATCGGATT

Full Affymetrix probeset data:

Annotations for 1626407_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime