Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626409_at:

>probe:Drosophila_2:1626409_at:215:561; Interrogation_Position=1024; Antisense; GGAAACTTTGAACCTTACAGCAACT
>probe:Drosophila_2:1626409_at:404:255; Interrogation_Position=1049; Antisense; CAAATGATATGTATTCCCAACCCTG
>probe:Drosophila_2:1626409_at:180:609; Interrogation_Position=1100; Antisense; TGAGCAATAGTTGGTCGAGACCCAC
>probe:Drosophila_2:1626409_at:239:309; Interrogation_Position=1121; Antisense; CCACTGCCAATTCCTTTAACAATTC
>probe:Drosophila_2:1626409_at:178:523; Interrogation_Position=1153; Antisense; GGGCCAAAATCAAGACCTGCAATAT
>probe:Drosophila_2:1626409_at:625:203; Interrogation_Position=739; Antisense; AAGCCCTACTACTATCAGGATGAGG
>probe:Drosophila_2:1626409_at:485:435; Interrogation_Position=760; Antisense; GAGGATTTGTCCGAGAACTTTGAAG
>probe:Drosophila_2:1626409_at:203:383; Interrogation_Position=796; Antisense; GAACAGCCACATCATGAGGATTACG
>probe:Drosophila_2:1626409_at:650:531; Interrogation_Position=831; Antisense; GGTGATGAGTGGTCCCCATAAATAT
>probe:Drosophila_2:1626409_at:20:97; Interrogation_Position=888; Antisense; AGATCAGGATCACGCACATGGTTAT
>probe:Drosophila_2:1626409_at:74:269; Interrogation_Position=904; Antisense; CATGGTTATGATAGTGCTGTGGCCT
>probe:Drosophila_2:1626409_at:630:333; Interrogation_Position=919; Antisense; GCTGTGGCCTTCAGTGGTCAGGATA
>probe:Drosophila_2:1626409_at:431:655; Interrogation_Position=942; Antisense; TAATAGCATTTCATCCTCCATGCCA
>probe:Drosophila_2:1626409_at:579:159; Interrogation_Position=993; Antisense; AAACAACCCGGCATCTGGTTATGGT

Paste this into a BLAST search page for me
GGAAACTTTGAACCTTACAGCAACTCAAATGATATGTATTCCCAACCCTGTGAGCAATAGTTGGTCGAGACCCACCCACTGCCAATTCCTTTAACAATTCGGGCCAAAATCAAGACCTGCAATATAAGCCCTACTACTATCAGGATGAGGGAGGATTTGTCCGAGAACTTTGAAGGAACAGCCACATCATGAGGATTACGGGTGATGAGTGGTCCCCATAAATATAGATCAGGATCACGCACATGGTTATCATGGTTATGATAGTGCTGTGGCCTGCTGTGGCCTTCAGTGGTCAGGATATAATAGCATTTCATCCTCCATGCCAAAACAACCCGGCATCTGGTTATGGT

Full Affymetrix probeset data:

Annotations for 1626409_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime