Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626411_at:

>probe:Drosophila_2:1626411_at:330:397; Interrogation_Position=2014; Antisense; GACAATACCGATGTCAGCGGCGCAC
>probe:Drosophila_2:1626411_at:501:105; Interrogation_Position=2045; Antisense; AGAAACTGCGTCTGAGCAACGCCGA
>probe:Drosophila_2:1626411_at:569:199; Interrogation_Position=2062; Antisense; AACGCCGACGTGTCTACGCGGACAA
>probe:Drosophila_2:1626411_at:324:559; Interrogation_Position=2081; Antisense; GGACAATAGCACACTCGATACCTCT
>probe:Drosophila_2:1626411_at:709:43; Interrogation_Position=2125; Antisense; ATCGACTTCACTAACACTGGACTGG
>probe:Drosophila_2:1626411_at:147:357; Interrogation_Position=2168; Antisense; GCACAGTGCCGTTTATGGACATCCA
>probe:Drosophila_2:1626411_at:547:557; Interrogation_Position=2184; Antisense; GGACATCCAGGACGTGGTCTCGAAT
>probe:Drosophila_2:1626411_at:466:259; Interrogation_Position=2219; Antisense; CACTAGCCGGCATTGGCATTTACTA
>probe:Drosophila_2:1626411_at:425:345; Interrogation_Position=2234; Antisense; GCATTTACTACAAGGGCCGCAACGG
>probe:Drosophila_2:1626411_at:208:215; Interrogation_Position=2281; Antisense; AAGATCATCACCTACGACTTCATGC
>probe:Drosophila_2:1626411_at:665:623; Interrogation_Position=2303; Antisense; TGCCCCACGTTCAGGTGCCAAAGAA
>probe:Drosophila_2:1626411_at:246:101; Interrogation_Position=2343; Antisense; AGAGAAGCGGTGCTGTTTCCATCCC
>probe:Drosophila_2:1626411_at:724:687; Interrogation_Position=2358; Antisense; TTTCCATCCCGCACATATGTCATAG
>probe:Drosophila_2:1626411_at:409:327; Interrogation_Position=2421; Antisense; GCGTTTAACTGTCGCATAGTCTAAG

Paste this into a BLAST search page for me
GACAATACCGATGTCAGCGGCGCACAGAAACTGCGTCTGAGCAACGCCGAAACGCCGACGTGTCTACGCGGACAAGGACAATAGCACACTCGATACCTCTATCGACTTCACTAACACTGGACTGGGCACAGTGCCGTTTATGGACATCCAGGACATCCAGGACGTGGTCTCGAATCACTAGCCGGCATTGGCATTTACTAGCATTTACTACAAGGGCCGCAACGGAAGATCATCACCTACGACTTCATGCTGCCCCACGTTCAGGTGCCAAAGAAAGAGAAGCGGTGCTGTTTCCATCCCTTTCCATCCCGCACATATGTCATAGGCGTTTAACTGTCGCATAGTCTAAG

Full Affymetrix probeset data:

Annotations for 1626411_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime