FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626412_at:

>probe:Drosophila_2:1626412_at:547:415; Interrogation_Position=504; Antisense; GAGCGCCAAAGTTGTCTGGACACGC
>probe:Drosophila_2:1626412_at:140:21; Interrogation_Position=540; Antisense; ATAGTTAATTCCGTGGCTGCGTTGT
>probe:Drosophila_2:1626412_at:164:727; Interrogation_Position=561; Antisense; TTGTGTGTAAATCCAGAGACGCGTC
>probe:Drosophila_2:1626412_at:412:105; Interrogation_Position=610; Antisense; AGAAATCCCTGAAGGATGCCCACTT
>probe:Drosophila_2:1626412_at:716:49; Interrogation_Position=625; Antisense; ATGCCCACTTCTCCGTTAAGATGAA
>probe:Drosophila_2:1626412_at:727:95; Interrogation_Position=685; Antisense; AGATTCTCAAGGACCATATGCCCAT
>probe:Drosophila_2:1626412_at:60:25; Interrogation_Position=700; Antisense; ATATGCCCATCGAGAGGTCGCGCAT
>probe:Drosophila_2:1626412_at:311:119; Interrogation_Position=727; Antisense; AGCTGCGCGTTAGCTTTGCTGGAAA
>probe:Drosophila_2:1626412_at:458:359; Interrogation_Position=763; Antisense; GCAAGCTCAAGGAATCGGTGGTCAA
>probe:Drosophila_2:1626412_at:298:251; Interrogation_Position=785; Antisense; CAAGTTGGCCAACGCAGTGGAGCAC
>probe:Drosophila_2:1626412_at:392:73; Interrogation_Position=811; Antisense; AGGAATGGGACGAGGCCACCTTGCA
>probe:Drosophila_2:1626412_at:281:145; Interrogation_Position=835; Antisense; ACTTAACCTTGCTCATAGATCCTGG
>probe:Drosophila_2:1626412_at:78:97; Interrogation_Position=851; Antisense; AGATCCTGGCCAATATCGTGTCATT
>probe:Drosophila_2:1626412_at:115:439; Interrogation_Position=951; Antisense; GAGGAACTCTTCTAGGCAATACAAT

Paste this into a BLAST search page for me
GAGCGCCAAAGTTGTCTGGACACGCATAGTTAATTCCGTGGCTGCGTTGTTTGTGTGTAAATCCAGAGACGCGTCAGAAATCCCTGAAGGATGCCCACTTATGCCCACTTCTCCGTTAAGATGAAAGATTCTCAAGGACCATATGCCCATATATGCCCATCGAGAGGTCGCGCATAGCTGCGCGTTAGCTTTGCTGGAAAGCAAGCTCAAGGAATCGGTGGTCAACAAGTTGGCCAACGCAGTGGAGCACAGGAATGGGACGAGGCCACCTTGCAACTTAACCTTGCTCATAGATCCTGGAGATCCTGGCCAATATCGTGTCATTGAGGAACTCTTCTAGGCAATACAAT

Full Affymetrix probeset data:

Annotations for 1626412_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720