FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626413_at:

>probe:Drosophila_2:1626413_at:396:637; Interrogation_Position=352; Antisense; TCGAGTTCGAGGATCGTCGCGACGC
>probe:Drosophila_2:1626413_at:654:629; Interrogation_Position=368; Antisense; TCGCGACGCTGAGGATGCGACCCGT
>probe:Drosophila_2:1626413_at:454:131; Interrogation_Position=420; Antisense; ACCCGCATCCGTGTCGAAATGTCAT
>probe:Drosophila_2:1626413_at:190:395; Interrogation_Position=435; Antisense; GAAATGTCATCAGGCCGTTCACGAG
>probe:Drosophila_2:1626413_at:343:27; Interrogation_Position=443; Antisense; ATCAGGCCGTTCACGAGAGGGTCGC
>probe:Drosophila_2:1626413_at:429:533; Interrogation_Position=573; Antisense; GGTGGACGCTATAGATCACGCTCAC
>probe:Drosophila_2:1626413_at:322:135; Interrogation_Position=614; Antisense; ACGCAGCCGCAGCTTTTCGAGGGAT
>probe:Drosophila_2:1626413_at:49:695; Interrogation_Position=628; Antisense; TTTCGAGGGATCGTCGCAGTCGCTC
>probe:Drosophila_2:1626413_at:645:627; Interrogation_Position=657; Antisense; TCCAGGGACCGCCATTAGATGAGAA
>probe:Drosophila_2:1626413_at:217:545; Interrogation_Position=693; Antisense; GGATGCAGCCCAAAACTGGACTCCA
>probe:Drosophila_2:1626413_at:600:673; Interrogation_Position=770; Antisense; TATACATAAAGTAGTACGGCCCCAG
>probe:Drosophila_2:1626413_at:315:487; Interrogation_Position=783; Antisense; GTACGGCCCCAGAGTTGAGGACAAA
>probe:Drosophila_2:1626413_at:44:171; Interrogation_Position=807; Antisense; AAAGGATCTGTTTTGCCAGACGAAA
>probe:Drosophila_2:1626413_at:275:183; Interrogation_Position=830; Antisense; AAAATGGCTCAACAGATTTCTGAAG

Paste this into a BLAST search page for me
TCGAGTTCGAGGATCGTCGCGACGCTCGCGACGCTGAGGATGCGACCCGTACCCGCATCCGTGTCGAAATGTCATGAAATGTCATCAGGCCGTTCACGAGATCAGGCCGTTCACGAGAGGGTCGCGGTGGACGCTATAGATCACGCTCACACGCAGCCGCAGCTTTTCGAGGGATTTTCGAGGGATCGTCGCAGTCGCTCTCCAGGGACCGCCATTAGATGAGAAGGATGCAGCCCAAAACTGGACTCCATATACATAAAGTAGTACGGCCCCAGGTACGGCCCCAGAGTTGAGGACAAAAAAGGATCTGTTTTGCCAGACGAAAAAAATGGCTCAACAGATTTCTGAAG

Full Affymetrix probeset data:

Annotations for 1626413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720