FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626414_at:

>probe:Drosophila_2:1626414_at:618:203; Interrogation_Position=1089; Antisense; AAGTTCTCCACGTGGACAAATCCCA
>probe:Drosophila_2:1626414_at:438:117; Interrogation_Position=1113; Antisense; AGCTACCGATCTCTGCCAGATGGAG
>probe:Drosophila_2:1626414_at:707:439; Interrogation_Position=1131; Antisense; GATGGAGGACTCACTAAGCGCTACA
>probe:Drosophila_2:1626414_at:680:665; Interrogation_Position=1152; Antisense; TACAAAATGGATGCCCTGCTGGACA
>probe:Drosophila_2:1626414_at:701:57; Interrogation_Position=1182; Antisense; ATGATCTACTACCTGACCAATTCGA
>probe:Drosophila_2:1626414_at:69:499; Interrogation_Position=1222; Antisense; GTCTCTATGCCGAGCAGTATGCCCA
>probe:Drosophila_2:1626414_at:329:433; Interrogation_Position=1285; Antisense; GAGTGCCAACTGGATGTGCCCGTTT
>probe:Drosophila_2:1626414_at:286:507; Interrogation_Position=1300; Antisense; GTGCCCGTTTCAAGAGCGACATTAT
>probe:Drosophila_2:1626414_at:7:417; Interrogation_Position=1313; Antisense; GAGCGACATTATGCAGTTCCTGGAT
>probe:Drosophila_2:1626414_at:238:491; Interrogation_Position=1355; Antisense; GTACACGAACCTAGTGCACAGCACT
>probe:Drosophila_2:1626414_at:214:149; Interrogation_Position=1399; Antisense; ACTTTGCCGCTCTAGAGGTTCCAAA
>probe:Drosophila_2:1626414_at:111:301; Interrogation_Position=933; Antisense; CCCTCTGGCTTTGAAGATTTCTTCT
>probe:Drosophila_2:1626414_at:295:695; Interrogation_Position=950; Antisense; TTTCTTCTTTCCCAAGTCTAACGAG
>probe:Drosophila_2:1626414_at:338:75; Interrogation_Position=991; Antisense; AGGAGAGTGGCTACTTCCACATCCA

Paste this into a BLAST search page for me
AAGTTCTCCACGTGGACAAATCCCAAGCTACCGATCTCTGCCAGATGGAGGATGGAGGACTCACTAAGCGCTACATACAAAATGGATGCCCTGCTGGACAATGATCTACTACCTGACCAATTCGAGTCTCTATGCCGAGCAGTATGCCCAGAGTGCCAACTGGATGTGCCCGTTTGTGCCCGTTTCAAGAGCGACATTATGAGCGACATTATGCAGTTCCTGGATGTACACGAACCTAGTGCACAGCACTACTTTGCCGCTCTAGAGGTTCCAAACCCTCTGGCTTTGAAGATTTCTTCTTTTCTTCTTTCCCAAGTCTAACGAGAGGAGAGTGGCTACTTCCACATCCA

Full Affymetrix probeset data:

Annotations for 1626414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720