Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626416_a_at:

>probe:Drosophila_2:1626416_a_at:23:129; Interrogation_Position=135; Antisense; ACCAGCACTTCGGTCAGGGACTGAA
>probe:Drosophila_2:1626416_a_at:280:57; Interrogation_Position=165; Antisense; ATGACCTCATGTCCTCCGTGTGGAA
>probe:Drosophila_2:1626416_a_at:383:153; Interrogation_Position=200; Antisense; ACAGTGCTGCGATCGGGATACCTGC
>probe:Drosophila_2:1626416_a_at:656:107; Interrogation_Position=249; Antisense; AGAAGCAGGAGTCCGGTTCCACCCT
>probe:Drosophila_2:1626416_a_at:549:9; Interrogation_Position=302; Antisense; ATTCTGGATGTGCAGCAGTTCTCGC
>probe:Drosophila_2:1626416_a_at:311:427; Interrogation_Position=332; Antisense; GAGATCACCGTCAAGGTGGCCGACA
>probe:Drosophila_2:1626416_a_at:274:581; Interrogation_Position=348; Antisense; TGGCCGACAAGTTCGTCATCGTGGA
>probe:Drosophila_2:1626416_a_at:235:555; Interrogation_Position=394; Antisense; GGACGAGCACGGATATGTCTCCCGC
>probe:Drosophila_2:1626416_a_at:557:183; Interrogation_Position=54; Antisense; AAAAGATGTCCGTAGTGCCACTGAT
>probe:Drosophila_2:1626416_a_at:543:621; Interrogation_Position=557; Antisense; TGCTGACCATCAAGGCGCCAATGAA
>probe:Drosophila_2:1626416_a_at:481:105; Interrogation_Position=599; Antisense; AGACTGAACGCCTTGTGCAGATCAC
>probe:Drosophila_2:1626416_a_at:627:509; Interrogation_Position=613; Antisense; GTGCAGATCACACAGACTGGTCCCT
>probe:Drosophila_2:1626416_a_at:551:503; Interrogation_Position=68; Antisense; GTGCCACTGATGTTCCGTGACTGGT
>probe:Drosophila_2:1626416_a_at:639:443; Interrogation_Position=95; Antisense; GATGAGCTCGACTTTCCAATGCGCA

Paste this into a BLAST search page for me
ACCAGCACTTCGGTCAGGGACTGAAATGACCTCATGTCCTCCGTGTGGAAACAGTGCTGCGATCGGGATACCTGCAGAAGCAGGAGTCCGGTTCCACCCTATTCTGGATGTGCAGCAGTTCTCGCGAGATCACCGTCAAGGTGGCCGACATGGCCGACAAGTTCGTCATCGTGGAGGACGAGCACGGATATGTCTCCCGCAAAAGATGTCCGTAGTGCCACTGATTGCTGACCATCAAGGCGCCAATGAAAGACTGAACGCCTTGTGCAGATCACGTGCAGATCACACAGACTGGTCCCTGTGCCACTGATGTTCCGTGACTGGTGATGAGCTCGACTTTCCAATGCGCA

Full Affymetrix probeset data:

Annotations for 1626416_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime