Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626417_at:

>probe:Drosophila_2:1626417_at:44:561; Interrogation_Position=6533; Antisense; GGAAACTTCAGCATCCATTACTGGT
>probe:Drosophila_2:1626417_at:5:105; Interrogation_Position=6612; Antisense; AGACGTTTACGCTAGCTGACCAAAA
>probe:Drosophila_2:1626417_at:237:255; Interrogation_Position=6632; Antisense; CAAAATCGCCGGTCACTAAATGATA
>probe:Drosophila_2:1626417_at:24:555; Interrogation_Position=6676; Antisense; GGCAGGAACCTTTACTAGAGCGGAT
>probe:Drosophila_2:1626417_at:120:121; Interrogation_Position=6694; Antisense; AGCGGATGGATTCTTGGCGTACTAT
>probe:Drosophila_2:1626417_at:463:223; Interrogation_Position=6771; Antisense; AAGGTATATTCGGATCCTATGCATA
>probe:Drosophila_2:1626417_at:705:273; Interrogation_Position=6865; Antisense; CTTGCAGCTAGGTGGCGGCATGATT
>probe:Drosophila_2:1626417_at:125:459; Interrogation_Position=6886; Antisense; GATTTGGGCCCTTGATTTAGATGAC
>probe:Drosophila_2:1626417_at:684:53; Interrogation_Position=6906; Antisense; ATGACTTTCGTGGACTTTGCGGTTG
>probe:Drosophila_2:1626417_at:586:719; Interrogation_Position=6922; Antisense; TTGCGGTTGCGGCAAGCACCCATTA
>probe:Drosophila_2:1626417_at:317:111; Interrogation_Position=6936; Antisense; AGCACCCATTACTCAGGACTCTTAG
>probe:Drosophila_2:1626417_at:698:555; Interrogation_Position=6951; Antisense; GGACTCTTAGTCAGGAGCTCCTAGG
>probe:Drosophila_2:1626417_at:546:417; Interrogation_Position=6965; Antisense; GAGCTCCTAGGCATTCCTGGACAAA
>probe:Drosophila_2:1626417_at:53:207; Interrogation_Position=7024; Antisense; AAGCTTGACCTGTATTCTATTCTAA

Paste this into a BLAST search page for me
GGAAACTTCAGCATCCATTACTGGTAGACGTTTACGCTAGCTGACCAAAACAAAATCGCCGGTCACTAAATGATAGGCAGGAACCTTTACTAGAGCGGATAGCGGATGGATTCTTGGCGTACTATAAGGTATATTCGGATCCTATGCATACTTGCAGCTAGGTGGCGGCATGATTGATTTGGGCCCTTGATTTAGATGACATGACTTTCGTGGACTTTGCGGTTGTTGCGGTTGCGGCAAGCACCCATTAAGCACCCATTACTCAGGACTCTTAGGGACTCTTAGTCAGGAGCTCCTAGGGAGCTCCTAGGCATTCCTGGACAAAAAGCTTGACCTGTATTCTATTCTAA

Full Affymetrix probeset data:

Annotations for 1626417_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime