Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626420_at:

>probe:Drosophila_2:1626420_at:688:561; Interrogation_Position=1215; Antisense; GGAACTATCAGGGAGCCAGCCAGAA
>probe:Drosophila_2:1626420_at:253:291; Interrogation_Position=1296; Antisense; CGGTGGTGCGGTATCTGGAATTCAA
>probe:Drosophila_2:1626420_at:626:391; Interrogation_Position=1323; Antisense; GAAACCGTGTGAAACTCAGCCTGGA
>probe:Drosophila_2:1626420_at:12:651; Interrogation_Position=1338; Antisense; TCAGCCTGGATGTTCACTCATTTGG
>probe:Drosophila_2:1626420_at:554:355; Interrogation_Position=1362; Antisense; GCAAATTCATTTTTTATCCCTACGG
>probe:Drosophila_2:1626420_at:654:563; Interrogation_Position=1460; Antisense; GGCAGGTACCGTGGAACGCGCTACA
>probe:Drosophila_2:1626420_at:417:115; Interrogation_Position=1526; Antisense; AGCTTGGACGACTTCGCCTATGGCA
>probe:Drosophila_2:1626420_at:402:311; Interrogation_Position=1541; Antisense; GCCTATGGCAATCTGGGAATCCCGC
>probe:Drosophila_2:1626420_at:395:119; Interrogation_Position=1581; Antisense; AGCTGCCCGGTGACGAGTTCCATGT
>probe:Drosophila_2:1626420_at:30:403; Interrogation_Position=1616; Antisense; GACATCATCCACGTCTGCAAGGAGA
>probe:Drosophila_2:1626420_at:346:361; Interrogation_Position=1632; Antisense; GCAAGGAGACATTCGCCGGCTTCAT
>probe:Drosophila_2:1626420_at:523:711; Interrogation_Position=1652; Antisense; TTCATCGAGTTCATCCGGCACGTCA
>probe:Drosophila_2:1626420_at:203:109; Interrogation_Position=1686; Antisense; AGAAGGCGCCACTGTATTTCCTAAG
>probe:Drosophila_2:1626420_at:127:33; Interrogation_Position=1753; Antisense; ATAAGTCACCTCGTTGTTAAGCATT

Paste this into a BLAST search page for me
GGAACTATCAGGGAGCCAGCCAGAACGGTGGTGCGGTATCTGGAATTCAAGAAACCGTGTGAAACTCAGCCTGGATCAGCCTGGATGTTCACTCATTTGGGCAAATTCATTTTTTATCCCTACGGGGCAGGTACCGTGGAACGCGCTACAAGCTTGGACGACTTCGCCTATGGCAGCCTATGGCAATCTGGGAATCCCGCAGCTGCCCGGTGACGAGTTCCATGTGACATCATCCACGTCTGCAAGGAGAGCAAGGAGACATTCGCCGGCTTCATTTCATCGAGTTCATCCGGCACGTCAAGAAGGCGCCACTGTATTTCCTAAGATAAGTCACCTCGTTGTTAAGCATT

Full Affymetrix probeset data:

Annotations for 1626420_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime