Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626421_at:

>probe:Drosophila_2:1626421_at:356:633; Interrogation_Position=1411; Antisense; TCGCGGCTTCAAAGTAAGTGGTCGT
>probe:Drosophila_2:1626421_at:511:655; Interrogation_Position=1425; Antisense; TAAGTGGTCGTTTCTTTGATTACAA
>probe:Drosophila_2:1626421_at:274:707; Interrogation_Position=1444; Antisense; TTACAACGAAGCTCTGGACGCCTAT
>probe:Drosophila_2:1626421_at:552:555; Interrogation_Position=1459; Antisense; GGACGCCTATGATGAGCCCGATTAT
>probe:Drosophila_2:1626421_at:638:461; Interrogation_Position=1478; Antisense; GATTATCCGCTGTTTGTCGCCTGGC
>probe:Drosophila_2:1626421_at:431:299; Interrogation_Position=1517; Antisense; CGCCACCTGGATTACTTCATAGACA
>probe:Drosophila_2:1626421_at:569:23; Interrogation_Position=1535; Antisense; ATAGACAGCGATGCGCTTTGGCACT
>probe:Drosophila_2:1626421_at:378:51; Interrogation_Position=1545; Antisense; ATGCGCTTTGGCACTGATTACTAAA
>probe:Drosophila_2:1626421_at:358:613; Interrogation_Position=1606; Antisense; TGAATACCTCTTTTTGTTTGCCGCT
>probe:Drosophila_2:1626421_at:163:299; Interrogation_Position=1627; Antisense; CGCTCTCTGTCCCATTGAATGTGTG
>probe:Drosophila_2:1626421_at:268:473; Interrogation_Position=1653; Antisense; GTTCATTTAGTTTTTGTCTCGCCTT
>probe:Drosophila_2:1626421_at:72:205; Interrogation_Position=1679; Antisense; AAGCGTTTCTTTGCTTTAAGCTCAC
>probe:Drosophila_2:1626421_at:283:657; Interrogation_Position=1695; Antisense; TAAGCTCACTGTTTAATTGCGTTAA
>probe:Drosophila_2:1626421_at:604:655; Interrogation_Position=1735; Antisense; TAAGGATATTAACCCGATTCCATGA

Paste this into a BLAST search page for me
TCGCGGCTTCAAAGTAAGTGGTCGTTAAGTGGTCGTTTCTTTGATTACAATTACAACGAAGCTCTGGACGCCTATGGACGCCTATGATGAGCCCGATTATGATTATCCGCTGTTTGTCGCCTGGCCGCCACCTGGATTACTTCATAGACAATAGACAGCGATGCGCTTTGGCACTATGCGCTTTGGCACTGATTACTAAATGAATACCTCTTTTTGTTTGCCGCTCGCTCTCTGTCCCATTGAATGTGTGGTTCATTTAGTTTTTGTCTCGCCTTAAGCGTTTCTTTGCTTTAAGCTCACTAAGCTCACTGTTTAATTGCGTTAATAAGGATATTAACCCGATTCCATGA

Full Affymetrix probeset data:

Annotations for 1626421_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime