FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626425_at:

>probe:Drosophila_2:1626425_at:604:519; Interrogation_Position=1038; Antisense; GTGGACAGCGACAACAAGCCCATCT
>probe:Drosophila_2:1626425_at:596:637; Interrogation_Position=1062; Antisense; TCGTTCCAGCAGACGTTCGAGGCAA
>probe:Drosophila_2:1626425_at:46:437; Interrogation_Position=1080; Antisense; GAGGCAAAGCGCTCCAACCATTTGG
>probe:Drosophila_2:1626425_at:189:79; Interrogation_Position=1129; Antisense; AGGTTCGTCAGATGTTCGTGCAGCG
>probe:Drosophila_2:1626425_at:464:555; Interrogation_Position=1193; Antisense; GGACCTGCACGCCAAGTTCGAGAAG
>probe:Drosophila_2:1626425_at:202:437; Interrogation_Position=1275; Antisense; GAGGAGGACTACCTTGACTTCCAGC
>probe:Drosophila_2:1626425_at:544:375; Interrogation_Position=1355; Antisense; GAAGAAGTAGAATCCGGCGCCGCCG
>probe:Drosophila_2:1626425_at:54:319; Interrogation_Position=1373; Antisense; GCCGCCGCCTCACAATGTATTGAGA
>probe:Drosophila_2:1626425_at:450:721; Interrogation_Position=1392; Antisense; TTGAGAATTCTGTGCGGTTCGCTTA
>probe:Drosophila_2:1626425_at:149:331; Interrogation_Position=1405; Antisense; GCGGTTCGCTTATCCCAAAGTAATT
>probe:Drosophila_2:1626425_at:456:245; Interrogation_Position=1426; Antisense; AATTATTGCTTTCTCATCTCGTTGT
>probe:Drosophila_2:1626425_at:682:37; Interrogation_Position=1441; Antisense; ATCTCGTTGTCTTTCATTTGTACTA
>probe:Drosophila_2:1626425_at:41:145; Interrogation_Position=1498; Antisense; ACTACACGCATATGTACGCAGGCAT
>probe:Drosophila_2:1626425_at:401:279; Interrogation_Position=989; Antisense; CTACGAGCTGTATCGCCAGAAGAGG

Paste this into a BLAST search page for me
GTGGACAGCGACAACAAGCCCATCTTCGTTCCAGCAGACGTTCGAGGCAAGAGGCAAAGCGCTCCAACCATTTGGAGGTTCGTCAGATGTTCGTGCAGCGGGACCTGCACGCCAAGTTCGAGAAGGAGGAGGACTACCTTGACTTCCAGCGAAGAAGTAGAATCCGGCGCCGCCGGCCGCCGCCTCACAATGTATTGAGATTGAGAATTCTGTGCGGTTCGCTTAGCGGTTCGCTTATCCCAAAGTAATTAATTATTGCTTTCTCATCTCGTTGTATCTCGTTGTCTTTCATTTGTACTAACTACACGCATATGTACGCAGGCATCTACGAGCTGTATCGCCAGAAGAGG

Full Affymetrix probeset data:

Annotations for 1626425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720