Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626426_at:

>probe:Drosophila_2:1626426_at:97:21; Interrogation_Position=1654; Antisense; ATATTGGTGGCGTGTTTGTTGTTCT
>probe:Drosophila_2:1626426_at:116:479; Interrogation_Position=1667; Antisense; GTTTGTTGTTCTCCTTTGTGGACTT
>probe:Drosophila_2:1626426_at:649:719; Interrogation_Position=1690; Antisense; TTGCGCTTGCAGTTGTTGTAGCCAT
>probe:Drosophila_2:1626426_at:122:73; Interrogation_Position=1786; Antisense; AGGAACTTCGTTTTGCAATGCACTG
>probe:Drosophila_2:1626426_at:549:361; Interrogation_Position=1800; Antisense; GCAATGCACTGCCATGGTTCAAAAT
>probe:Drosophila_2:1626426_at:539:671; Interrogation_Position=1832; Antisense; TAGACCGCGAAAACGAAGTTGCCTT
>probe:Drosophila_2:1626426_at:538:635; Interrogation_Position=1877; Antisense; TCGTTGCCGATGTGGTTTCTGCTAC
>probe:Drosophila_2:1626426_at:271:715; Interrogation_Position=1893; Antisense; TTCTGCTACGGTCTTCATTTCCGAA
>probe:Drosophila_2:1626426_at:11:17; Interrogation_Position=1909; Antisense; ATTTCCGAAGGCGATGCAGACTCCT
>probe:Drosophila_2:1626426_at:339:405; Interrogation_Position=1927; Antisense; GACTCCTCAGTGCTCATGATACCAA
>probe:Drosophila_2:1626426_at:573:383; Interrogation_Position=1957; Antisense; GAACATCATGTTCACGAGTTAGCTG
>probe:Drosophila_2:1626426_at:304:475; Interrogation_Position=1974; Antisense; GTTAGCTGATACTCGACCACAATTA
>probe:Drosophila_2:1626426_at:158:665; Interrogation_Position=2001; Antisense; TAAAGTATCCCACTGTCACCTGGAA
>probe:Drosophila_2:1626426_at:491:573; Interrogation_Position=2040; Antisense; GGCTGGTGATGGATATCTTCGATTC

Paste this into a BLAST search page for me
ATATTGGTGGCGTGTTTGTTGTTCTGTTTGTTGTTCTCCTTTGTGGACTTTTGCGCTTGCAGTTGTTGTAGCCATAGGAACTTCGTTTTGCAATGCACTGGCAATGCACTGCCATGGTTCAAAATTAGACCGCGAAAACGAAGTTGCCTTTCGTTGCCGATGTGGTTTCTGCTACTTCTGCTACGGTCTTCATTTCCGAAATTTCCGAAGGCGATGCAGACTCCTGACTCCTCAGTGCTCATGATACCAAGAACATCATGTTCACGAGTTAGCTGGTTAGCTGATACTCGACCACAATTATAAAGTATCCCACTGTCACCTGGAAGGCTGGTGATGGATATCTTCGATTC

Full Affymetrix probeset data:

Annotations for 1626426_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime