Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626429_at:

>probe:Drosophila_2:1626429_at:464:147; Interrogation_Position=1952; Antisense; ACTATCAAGCGCAGCTCCAAGGAGT
>probe:Drosophila_2:1626429_at:53:79; Interrogation_Position=1997; Antisense; AGGATTACATACACCGAGCTCTACA
>probe:Drosophila_2:1626429_at:638:309; Interrogation_Position=2036; Antisense; GCCAGCGAGGGCAAGTACGACTTTC
>probe:Drosophila_2:1626429_at:260:53; Interrogation_Position=2138; Antisense; ATGCAGTTCTACTTCTTTGTCTCGC
>probe:Drosophila_2:1626429_at:231:719; Interrogation_Position=2165; Antisense; TTCGCCGAGACGTACGAACAGTTCT
>probe:Drosophila_2:1626429_at:583:641; Interrogation_Position=2189; Antisense; TCTAACTTTGATTACACCTACTCCT
>probe:Drosophila_2:1626429_at:602:411; Interrogation_Position=2270; Antisense; GACCGCCAGATCGATGAATCCGACT
>probe:Drosophila_2:1626429_at:350:367; Interrogation_Position=2285; Antisense; GAATCCGACTTCTTTGTGCCTAATG
>probe:Drosophila_2:1626429_at:600:505; Interrogation_Position=2300; Antisense; GTGCCTAATGGCTTCTTTAAGGACG
>probe:Drosophila_2:1626429_at:333:139; Interrogation_Position=2322; Antisense; ACGTCAAGGTCTACTACGTCGACAC
>probe:Drosophila_2:1626429_at:674:137; Interrogation_Position=2337; Antisense; ACGTCGACACCTTTGCCAAGTACTT
>probe:Drosophila_2:1626429_at:700:107; Interrogation_Position=2364; Antisense; AGAAGAAGTACACCCAGTTCGGCAC
>probe:Drosophila_2:1626429_at:413:203; Interrogation_Position=2412; Antisense; AAGCCACACTGGATCTAGCTCTTAG
>probe:Drosophila_2:1626429_at:240:675; Interrogation_Position=2427; Antisense; TAGCTCTTAGCAATGTCGCAGGCAA

Paste this into a BLAST search page for me
ACTATCAAGCGCAGCTCCAAGGAGTAGGATTACATACACCGAGCTCTACAGCCAGCGAGGGCAAGTACGACTTTCATGCAGTTCTACTTCTTTGTCTCGCTTCGCCGAGACGTACGAACAGTTCTTCTAACTTTGATTACACCTACTCCTGACCGCCAGATCGATGAATCCGACTGAATCCGACTTCTTTGTGCCTAATGGTGCCTAATGGCTTCTTTAAGGACGACGTCAAGGTCTACTACGTCGACACACGTCGACACCTTTGCCAAGTACTTAGAAGAAGTACACCCAGTTCGGCACAAGCCACACTGGATCTAGCTCTTAGTAGCTCTTAGCAATGTCGCAGGCAA

Full Affymetrix probeset data:

Annotations for 1626429_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime