FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626431_at:

>probe:Drosophila_2:1626431_at:130:399; Interrogation_Position=396; Antisense; GACACGTGAAATGCCTGAGCGAAAT
>probe:Drosophila_2:1626431_at:382:545; Interrogation_Position=427; Antisense; GGATCTGGATTACATATTCCGCAAG
>probe:Drosophila_2:1626431_at:486:107; Interrogation_Position=468; Antisense; AGAAGCTACAGTCGCAGTTTCCCGC
>probe:Drosophila_2:1626431_at:655:17; Interrogation_Position=494; Antisense; ATTTACGCCGAAGTTCAGCCGCAGC
>probe:Drosophila_2:1626431_at:2:125; Interrogation_Position=510; Antisense; AGCCGCAGCGTAGCAGTTTGGCTGA
>probe:Drosophila_2:1626431_at:280:73; Interrogation_Position=543; Antisense; AGGATGATACGGAAGCCCAGGCTAA
>probe:Drosophila_2:1626431_at:507:211; Interrogation_Position=569; Antisense; AAGACTGCAGAAACACCTGCTCCTG
>probe:Drosophila_2:1626431_at:390:131; Interrogation_Position=604; Antisense; ACCTGTCCTATCCACCAAGAAAAGT
>probe:Drosophila_2:1626431_at:100:185; Interrogation_Position=623; Antisense; AAAAGTGCCGCCACCATAGAGTACG
>probe:Drosophila_2:1626431_at:69:455; Interrogation_Position=700; Antisense; GATCAAGCGAGTTTGTTCCGTGGAA
>probe:Drosophila_2:1626431_at:123:391; Interrogation_Position=722; Antisense; GAAACTGCCAATCCCAATGATTCCT
>probe:Drosophila_2:1626431_at:126:633; Interrogation_Position=746; Antisense; TCCGACTGCACATCCGAGGATACAG
>probe:Drosophila_2:1626431_at:639:313; Interrogation_Position=776; Antisense; GCCTAATTAGCTTTAGTCCCTCGAT
>probe:Drosophila_2:1626431_at:479:481; Interrogation_Position=840; Antisense; GTATAACCTGCTACTACATACAAGG

Paste this into a BLAST search page for me
GACACGTGAAATGCCTGAGCGAAATGGATCTGGATTACATATTCCGCAAGAGAAGCTACAGTCGCAGTTTCCCGCATTTACGCCGAAGTTCAGCCGCAGCAGCCGCAGCGTAGCAGTTTGGCTGAAGGATGATACGGAAGCCCAGGCTAAAAGACTGCAGAAACACCTGCTCCTGACCTGTCCTATCCACCAAGAAAAGTAAAAGTGCCGCCACCATAGAGTACGGATCAAGCGAGTTTGTTCCGTGGAAGAAACTGCCAATCCCAATGATTCCTTCCGACTGCACATCCGAGGATACAGGCCTAATTAGCTTTAGTCCCTCGATGTATAACCTGCTACTACATACAAGG

Full Affymetrix probeset data:

Annotations for 1626431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720