FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626433_at:

>probe:Drosophila_2:1626433_at:323:29; Interrogation_Position=121; Antisense; ATACGTTTCGTACGCCTGGGATGCA
>probe:Drosophila_2:1626433_at:637:593; Interrogation_Position=137; Antisense; TGGGATGCACCAATCGGCCTTTTTA
>probe:Drosophila_2:1626433_at:689:237; Interrogation_Position=148; Antisense; AATCGGCCTTTTTATCACATTGTCG
>probe:Drosophila_2:1626433_at:286:259; Interrogation_Position=163; Antisense; CACATTGTCGTCATGGAGAGGCGCA
>probe:Drosophila_2:1626433_at:453:551; Interrogation_Position=177; Antisense; GGAGAGGCGCAAGAACCAGCACCAG
>probe:Drosophila_2:1626433_at:426:113; Interrogation_Position=194; Antisense; AGCACCAGCCTGTCATCGAGCAGGT
>probe:Drosophila_2:1626433_at:18:13; Interrogation_Position=245; Antisense; ATTACAACGAACGACTGGTGGCCCT
>probe:Drosophila_2:1626433_at:184:143; Interrogation_Position=258; Antisense; ACTGGTGGCCCTGAACACGGAGAGA
>probe:Drosophila_2:1626433_at:83:103; Interrogation_Position=278; Antisense; AGAGAATTCGCTATTGGCTGGGCAA
>probe:Drosophila_2:1626433_at:463:525; Interrogation_Position=297; Antisense; GGGCAAAGGTGCACACTTGTCCACG
>probe:Drosophila_2:1626433_at:329:383; Interrogation_Position=331; Antisense; GAACTCCTGGGAATTGCCGGACTAC
>probe:Drosophila_2:1626433_at:359:597; Interrogation_Position=461; Antisense; TGTGCCTCAATAAAAGCCTCCTTTT
>probe:Drosophila_2:1626433_at:306:243; Interrogation_Position=55; Antisense; AATATCGGGATGTCTCTATCGCCAG
>probe:Drosophila_2:1626433_at:92:125; Interrogation_Position=78; Antisense; AGCCAGTGGCATTGGTCGTTTCTAC

Paste this into a BLAST search page for me
ATACGTTTCGTACGCCTGGGATGCATGGGATGCACCAATCGGCCTTTTTAAATCGGCCTTTTTATCACATTGTCGCACATTGTCGTCATGGAGAGGCGCAGGAGAGGCGCAAGAACCAGCACCAGAGCACCAGCCTGTCATCGAGCAGGTATTACAACGAACGACTGGTGGCCCTACTGGTGGCCCTGAACACGGAGAGAAGAGAATTCGCTATTGGCTGGGCAAGGGCAAAGGTGCACACTTGTCCACGGAACTCCTGGGAATTGCCGGACTACTGTGCCTCAATAAAAGCCTCCTTTTAATATCGGGATGTCTCTATCGCCAGAGCCAGTGGCATTGGTCGTTTCTAC

Full Affymetrix probeset data:

Annotations for 1626433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720