Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626435_at:

>probe:Drosophila_2:1626435_at:332:149; Interrogation_Position=293; Antisense; ACTTTATGCAGTTCTTCGCCGATGA
>probe:Drosophila_2:1626435_at:589:213; Interrogation_Position=352; Antisense; AAGAGCTCCAAGTTCACGGTTCTGT
>probe:Drosophila_2:1626435_at:315:19; Interrogation_Position=402; Antisense; ATTTCCGGGTGATGATTTCGCCTGC
>probe:Drosophila_2:1626435_at:86:19; Interrogation_Position=416; Antisense; ATTTCGCCTGCGAGACCTTTGGAGG
>probe:Drosophila_2:1626435_at:576:433; Interrogation_Position=442; Antisense; GAGGGCGTCGGTTATAAGTGCTATA
>probe:Drosophila_2:1626435_at:436:695; Interrogation_Position=474; Antisense; TTTCCCACTGATCAGCAATGCCATA
>probe:Drosophila_2:1626435_at:398:669; Interrogation_Position=512; Antisense; TAGAGATCGAGGGTTCCACCTTCAG
>probe:Drosophila_2:1626435_at:161:423; Interrogation_Position=559; Antisense; GAGAATCTCGACAGTGTGACCAGCA
>probe:Drosophila_2:1626435_at:298:263; Interrogation_Position=579; Antisense; CAGCACCCAGGTTAATCGTCATTTG
>probe:Drosophila_2:1626435_at:208:605; Interrogation_Position=602; Antisense; TGATTGGCGAGATCATCACTCCGCA
>probe:Drosophila_2:1626435_at:76:81; Interrogation_Position=694; Antisense; AGGGAGGCCTTTGAACTGGTCACCG
>probe:Drosophila_2:1626435_at:689:69; Interrogation_Position=776; Antisense; AGGCCTATCTCTACAACTCGGAGTG
>probe:Drosophila_2:1626435_at:217:15; Interrogation_Position=814; Antisense; ATTTTGGTGGCTCTAACGGCGGACA
>probe:Drosophila_2:1626435_at:310:213; Interrogation_Position=841; Antisense; AAGAGCACCATTTACTTCACCAGAC

Paste this into a BLAST search page for me
ACTTTATGCAGTTCTTCGCCGATGAAAGAGCTCCAAGTTCACGGTTCTGTATTTCCGGGTGATGATTTCGCCTGCATTTCGCCTGCGAGACCTTTGGAGGGAGGGCGTCGGTTATAAGTGCTATATTTCCCACTGATCAGCAATGCCATATAGAGATCGAGGGTTCCACCTTCAGGAGAATCTCGACAGTGTGACCAGCACAGCACCCAGGTTAATCGTCATTTGTGATTGGCGAGATCATCACTCCGCAAGGGAGGCCTTTGAACTGGTCACCGAGGCCTATCTCTACAACTCGGAGTGATTTTGGTGGCTCTAACGGCGGACAAAGAGCACCATTTACTTCACCAGAC

Full Affymetrix probeset data:

Annotations for 1626435_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime