FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626436_at:

>probe:Drosophila_2:1626436_at:467:435; Interrogation_Position=483; Antisense; GAGGTAACCGCCCTGGACTTGTGTC
>probe:Drosophila_2:1626436_at:167:509; Interrogation_Position=522; Antisense; GTGCTGCAGGCGGATTTCCTCAAAG
>probe:Drosophila_2:1626436_at:690:111; Interrogation_Position=608; Antisense; AGCAAGCCACTACGAGTGCGTCATT
>probe:Drosophila_2:1626436_at:35:433; Interrogation_Position=621; Antisense; GAGTGCGTCATTTTCAGTTTGCTAC
>probe:Drosophila_2:1626436_at:154:565; Interrogation_Position=647; Antisense; GGAATACATGCCCAGCGCCGAGCAG
>probe:Drosophila_2:1626436_at:435:101; Interrogation_Position=670; Antisense; AGAGACTACAGTGCTGCCTTCAGGC
>probe:Drosophila_2:1626436_at:681:293; Interrogation_Position=713; Antisense; CGAGGGCATCCTTGTGCTCATCACA
>probe:Drosophila_2:1626436_at:214:647; Interrogation_Position=772; Antisense; TCATGAAAAACTGGCGCTACTCCCT
>probe:Drosophila_2:1626436_at:68:467; Interrogation_Position=803; Antisense; GATTGGACTGCTACGGGTACGCTTC
>probe:Drosophila_2:1626436_at:138:135; Interrogation_Position=821; Antisense; ACGCTTCGAGAAGTTGCCGCACATA
>probe:Drosophila_2:1626436_at:276:357; Interrogation_Position=839; Antisense; GCACATATCGTGCATGGTGTTCCGC
>probe:Drosophila_2:1626436_at:338:113; Interrogation_Position=889; Antisense; AGCACTGGGCGAGCATTCACCGGGA
>probe:Drosophila_2:1626436_at:450:543; Interrogation_Position=937; Antisense; GGATACCGCAGGACGATAGCTAGAT
>probe:Drosophila_2:1626436_at:371:25; Interrogation_Position=990; Antisense; ATATGTCCACGTCTACTTATTTATG

Paste this into a BLAST search page for me
GAGGTAACCGCCCTGGACTTGTGTCGTGCTGCAGGCGGATTTCCTCAAAGAGCAAGCCACTACGAGTGCGTCATTGAGTGCGTCATTTTCAGTTTGCTACGGAATACATGCCCAGCGCCGAGCAGAGAGACTACAGTGCTGCCTTCAGGCCGAGGGCATCCTTGTGCTCATCACATCATGAAAAACTGGCGCTACTCCCTGATTGGACTGCTACGGGTACGCTTCACGCTTCGAGAAGTTGCCGCACATAGCACATATCGTGCATGGTGTTCCGCAGCACTGGGCGAGCATTCACCGGGAGGATACCGCAGGACGATAGCTAGATATATGTCCACGTCTACTTATTTATG

Full Affymetrix probeset data:

Annotations for 1626436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720