FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626438_at:

>probe:Drosophila_2:1626438_at:715:555; Interrogation_Position=246; Antisense; GGACGCGCCTTCAAAAACTTAGCGG
>probe:Drosophila_2:1626438_at:144:321; Interrogation_Position=250; Antisense; GCGCCTTCAAAAACTTAGCGGCATC
>probe:Drosophila_2:1626438_at:360:135; Interrogation_Position=458; Antisense; ACGCGCCTTCAAAGTGCAGTCCAAA
>probe:Drosophila_2:1626438_at:540:347; Interrogation_Position=473; Antisense; GCAGTCCAAAAGAAACGCACGCGAA
>probe:Drosophila_2:1626438_at:517:389; Interrogation_Position=484; Antisense; GAAACGCACGCGAAAAGTGAAACCT
>probe:Drosophila_2:1626438_at:290:667; Interrogation_Position=535; Antisense; TACTAAATGTTTACTGGGCCATCTT
>probe:Drosophila_2:1626438_at:7:599; Interrogation_Position=542; Antisense; TGTTTACTGGGCCATCTTAACAATG
>probe:Drosophila_2:1626438_at:313:143; Interrogation_Position=547; Antisense; ACTGGGCCATCTTAACAATGGAAAC
>probe:Drosophila_2:1626438_at:516:79; Interrogation_Position=595; Antisense; AGGGATCGGTTCAAAGACCGCCTCT
>probe:Drosophila_2:1626438_at:107:173; Interrogation_Position=607; Antisense; AAAGACCGCCTCTATTTTGGCCGTG
>probe:Drosophila_2:1626438_at:373:271; Interrogation_Position=618; Antisense; CTATTTTGGCCGTGCACAGATCCCG
>probe:Drosophila_2:1626438_at:556:299; Interrogation_Position=641; Antisense; CGCCTGGGTTGCTTCAAGAATCTAA
>probe:Drosophila_2:1626438_at:283:287; Interrogation_Position=644; Antisense; CTGGGTTGCTTCAAGAATCTAATTG
>probe:Drosophila_2:1626438_at:394:193; Interrogation_Position=659; Antisense; AATCTAATTGAAGTCAAATCCCTGC

Paste this into a BLAST search page for me
GGACGCGCCTTCAAAAACTTAGCGGGCGCCTTCAAAAACTTAGCGGCATCACGCGCCTTCAAAGTGCAGTCCAAAGCAGTCCAAAAGAAACGCACGCGAAGAAACGCACGCGAAAAGTGAAACCTTACTAAATGTTTACTGGGCCATCTTTGTTTACTGGGCCATCTTAACAATGACTGGGCCATCTTAACAATGGAAACAGGGATCGGTTCAAAGACCGCCTCTAAAGACCGCCTCTATTTTGGCCGTGCTATTTTGGCCGTGCACAGATCCCGCGCCTGGGTTGCTTCAAGAATCTAACTGGGTTGCTTCAAGAATCTAATTGAATCTAATTGAAGTCAAATCCCTGC

Full Affymetrix probeset data:

Annotations for 1626438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720