FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626439_at:

>probe:Drosophila_2:1626439_at:79:291; Interrogation_Position=148; Antisense; CGGTGCCACAGTTTGTCTACTCCGC
>probe:Drosophila_2:1626439_at:664:569; Interrogation_Position=174; Antisense; GGCTATCCGGCCGTGGGATACGCCT
>probe:Drosophila_2:1626439_at:473:591; Interrogation_Position=187; Antisense; TGGGATACGCCTCCCCGTACGTCTA
>probe:Drosophila_2:1626439_at:238:459; Interrogation_Position=20; Antisense; GATTTTGTTTGTCAAGTCGAGAATT
>probe:Drosophila_2:1626439_at:164:489; Interrogation_Position=203; Antisense; GTACGTCTACTACGGCTGAACTCAA
>probe:Drosophila_2:1626439_at:165:141; Interrogation_Position=214; Antisense; ACGGCTGAACTCAATATCCGGATTC
>probe:Drosophila_2:1626439_at:400:613; Interrogation_Position=219; Antisense; TGAACTCAATATCCGGATTCACCGA
>probe:Drosophila_2:1626439_at:45:461; Interrogation_Position=234; Antisense; GATTCACCGAATCAAACCCTTTCGA
>probe:Drosophila_2:1626439_at:681:649; Interrogation_Position=245; Antisense; TCAAACCCTTTCGACATGGACATGG
>probe:Drosophila_2:1626439_at:196:557; Interrogation_Position=268; Antisense; GGACAAGCAGTTTGATTTACTTTAT
>probe:Drosophila_2:1626439_at:108:149; Interrogation_Position=299; Antisense; ACTTTGGTATATATTTCATTTCTGA
>probe:Drosophila_2:1626439_at:133:497; Interrogation_Position=35; Antisense; GTCGAGAATTAACCCTTTCGTCATC
>probe:Drosophila_2:1626439_at:637:299; Interrogation_Position=47; Antisense; CCCTTTCGTCATCATGCTGAAGCTG
>probe:Drosophila_2:1626439_at:373:645; Interrogation_Position=58; Antisense; TCATGCTGAAGCTGGTACTCCTCCT

Paste this into a BLAST search page for me
CGGTGCCACAGTTTGTCTACTCCGCGGCTATCCGGCCGTGGGATACGCCTTGGGATACGCCTCCCCGTACGTCTAGATTTTGTTTGTCAAGTCGAGAATTGTACGTCTACTACGGCTGAACTCAAACGGCTGAACTCAATATCCGGATTCTGAACTCAATATCCGGATTCACCGAGATTCACCGAATCAAACCCTTTCGATCAAACCCTTTCGACATGGACATGGGGACAAGCAGTTTGATTTACTTTATACTTTGGTATATATTTCATTTCTGAGTCGAGAATTAACCCTTTCGTCATCCCCTTTCGTCATCATGCTGAAGCTGTCATGCTGAAGCTGGTACTCCTCCT

Full Affymetrix probeset data:

Annotations for 1626439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720