FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626441_at:

>probe:Drosophila_2:1626441_at:644:349; Interrogation_Position=123; Antisense; GCAGACCTTGAGAAACATTACCGAT
>probe:Drosophila_2:1626441_at:723:195; Interrogation_Position=165; Antisense; AACGGTTTCGGCCTTGAAGAGCAAG
>probe:Drosophila_2:1626441_at:236:311; Interrogation_Position=200; Antisense; GCCAGGAATCCTTCGAGGCGGAGAT
>probe:Drosophila_2:1626441_at:401:331; Interrogation_Position=217; Antisense; GCGGAGATCCAAGGTGCCATTACAG
>probe:Drosophila_2:1626441_at:442:113; Interrogation_Position=240; Antisense; AGCACCCAATCCTGCCAAGAAAAGG
>probe:Drosophila_2:1626441_at:419:437; Interrogation_Position=303; Antisense; GAGGAGTCTGCTACCAATGCCAGTA
>probe:Drosophila_2:1626441_at:719:233; Interrogation_Position=318; Antisense; AATGCCAGTACCCAATCTCAGATCG
>probe:Drosophila_2:1626441_at:413:451; Interrogation_Position=338; Antisense; GATCGGAAACTATCCTGCAGGTGGA
>probe:Drosophila_2:1626441_at:695:413; Interrogation_Position=364; Antisense; GAGCCTTTTGTGTGTCTCGAAACGA
>probe:Drosophila_2:1626441_at:679:203; Interrogation_Position=414; Antisense; AACCACTCACCTGATGGCGCGGAAA
>probe:Drosophila_2:1626441_at:184:391; Interrogation_Position=435; Antisense; GAAACCATATGGAGCTCTCATCCGG
>probe:Drosophila_2:1626441_at:649:143; Interrogation_Position=462; Antisense; ACTGTATCGGTCAGCCAGGCGGAAG
>probe:Drosophila_2:1626441_at:667:65; Interrogation_Position=553; Antisense; ATGGAATGTTACCACTGCTGCTGCT
>probe:Drosophila_2:1626441_at:251:621; Interrogation_Position=571; Antisense; TGCTGCTCAGCGTGTTGCATAGAGT

Paste this into a BLAST search page for me
GCAGACCTTGAGAAACATTACCGATAACGGTTTCGGCCTTGAAGAGCAAGGCCAGGAATCCTTCGAGGCGGAGATGCGGAGATCCAAGGTGCCATTACAGAGCACCCAATCCTGCCAAGAAAAGGGAGGAGTCTGCTACCAATGCCAGTAAATGCCAGTACCCAATCTCAGATCGGATCGGAAACTATCCTGCAGGTGGAGAGCCTTTTGTGTGTCTCGAAACGAAACCACTCACCTGATGGCGCGGAAAGAAACCATATGGAGCTCTCATCCGGACTGTATCGGTCAGCCAGGCGGAAGATGGAATGTTACCACTGCTGCTGCTTGCTGCTCAGCGTGTTGCATAGAGT

Full Affymetrix probeset data:

Annotations for 1626441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720