FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626442_at:

>probe:Drosophila_2:1626442_at:577:305; Interrogation_Position=143; Antisense; CCGGCATCATCTTGCATAACCGATA
>probe:Drosophila_2:1626442_at:301:167; Interrogation_Position=190; Antisense; AAATGCAATCCGTGACCAGACAAAC
>probe:Drosophila_2:1626442_at:396:85; Interrogation_Position=245; Antisense; AGTGAGCTATCTATCGACGAGTGGC
>probe:Drosophila_2:1626442_at:388:225; Interrogation_Position=315; Antisense; AAGGAACCAAAGACGCGCACCGAGA
>probe:Drosophila_2:1626442_at:26:291; Interrogation_Position=328; Antisense; CGCGCACCGAGAAGCTAATGGCCTT
>probe:Drosophila_2:1626442_at:55:229; Interrogation_Position=344; Antisense; AATGGCCTTCCAGAAGAAGCTGCGC
>probe:Drosophila_2:1626442_at:517:375; Interrogation_Position=359; Antisense; GAAGCTGCGCGCTAAAACGCCGCTG
>probe:Drosophila_2:1626442_at:266:361; Interrogation_Position=385; Antisense; GCAAGCTGGATGAATTCTCGCGACA
>probe:Drosophila_2:1626442_at:327:635; Interrogation_Position=402; Antisense; TCGCGACATCCGTACCAGGAGAAGG
>probe:Drosophila_2:1626442_at:726:551; Interrogation_Position=419; Antisense; GGAGAAGGAACCACTCAAGCCCTGG
>probe:Drosophila_2:1626442_at:605:247; Interrogation_Position=446; Antisense; CAATCAGACCAATCCGTATACGGGC
>probe:Drosophila_2:1626442_at:482:359; Interrogation_Position=523; Antisense; GCAAGGGACGCGTCTCCGATTTCTA
>probe:Drosophila_2:1626442_at:198:643; Interrogation_Position=535; Antisense; TCTCCGATTTCTAGTGCCCAAATGA
>probe:Drosophila_2:1626442_at:709:17; Interrogation_Position=686; Antisense; ATTTGCATTGCACTTATTGGGCAGA

Paste this into a BLAST search page for me
CCGGCATCATCTTGCATAACCGATAAAATGCAATCCGTGACCAGACAAACAGTGAGCTATCTATCGACGAGTGGCAAGGAACCAAAGACGCGCACCGAGACGCGCACCGAGAAGCTAATGGCCTTAATGGCCTTCCAGAAGAAGCTGCGCGAAGCTGCGCGCTAAAACGCCGCTGGCAAGCTGGATGAATTCTCGCGACATCGCGACATCCGTACCAGGAGAAGGGGAGAAGGAACCACTCAAGCCCTGGCAATCAGACCAATCCGTATACGGGCGCAAGGGACGCGTCTCCGATTTCTATCTCCGATTTCTAGTGCCCAAATGAATTTGCATTGCACTTATTGGGCAGA

Full Affymetrix probeset data:

Annotations for 1626442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720