FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626443_at:

>probe:Drosophila_2:1626443_at:387:109; Interrogation_Position=110; Antisense; AGAAGGACTCCAAAGACCTGGACGA
>probe:Drosophila_2:1626443_at:461:555; Interrogation_Position=135; Antisense; GGACGACATGGCCTTCAAGCAAAAG
>probe:Drosophila_2:1626443_at:572:331; Interrogation_Position=187; Antisense; GCGGCCAAGGCGAACGCCTCAAAGA
>probe:Drosophila_2:1626443_at:618:197; Interrogation_Position=199; Antisense; AACGCCTCAAAGAAGGGTCCTCTCG
>probe:Drosophila_2:1626443_at:316:503; Interrogation_Position=215; Antisense; GTCCTCTCGTAGGAGGCGGCATCAA
>probe:Drosophila_2:1626443_at:319:211; Interrogation_Position=250; Antisense; AAGAAGTGAAGCTGCCACGCCTCCA
>probe:Drosophila_2:1626443_at:349:39; Interrogation_Position=274; Antisense; ATCTGTAGTCCGCAACCCACTGGAT
>probe:Drosophila_2:1626443_at:272:201; Interrogation_Position=287; Antisense; AACCCACTGGATTCTGGACGCTGAA
>probe:Drosophila_2:1626443_at:466:555; Interrogation_Position=302; Antisense; GGACGCTGAATTGCCAGCCGAAGCA
>probe:Drosophila_2:1626443_at:498:377; Interrogation_Position=321; Antisense; GAAGCACACCCATGTGGACCATAAT
>probe:Drosophila_2:1626443_at:35:553; Interrogation_Position=336; Antisense; GGACCATAATCTTTTTATACTTACG
>probe:Drosophila_2:1626443_at:73:25; Interrogation_Position=372; Antisense; ATAGATCATTGTACGTCAGGATAGA
>probe:Drosophila_2:1626443_at:619:31; Interrogation_Position=50; Antisense; ATAAGCGAGCAAGTATGTCTGGACG
>probe:Drosophila_2:1626443_at:562:369; Interrogation_Position=99; Antisense; GAAGGCGCCGAAGAAGGACTCCAAA

Paste this into a BLAST search page for me
AGAAGGACTCCAAAGACCTGGACGAGGACGACATGGCCTTCAAGCAAAAGGCGGCCAAGGCGAACGCCTCAAAGAAACGCCTCAAAGAAGGGTCCTCTCGGTCCTCTCGTAGGAGGCGGCATCAAAAGAAGTGAAGCTGCCACGCCTCCAATCTGTAGTCCGCAACCCACTGGATAACCCACTGGATTCTGGACGCTGAAGGACGCTGAATTGCCAGCCGAAGCAGAAGCACACCCATGTGGACCATAATGGACCATAATCTTTTTATACTTACGATAGATCATTGTACGTCAGGATAGAATAAGCGAGCAAGTATGTCTGGACGGAAGGCGCCGAAGAAGGACTCCAAA

Full Affymetrix probeset data:

Annotations for 1626443_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720