FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626444_at:

>probe:Drosophila_2:1626444_at:224:125; Interrogation_Position=1034; Antisense; AGCCCGAAGCGGTATTCGCTGCCGA
>probe:Drosophila_2:1626444_at:9:349; Interrogation_Position=1071; Antisense; GCAGGCGGACAAGCTGAAGCCCCAA
>probe:Drosophila_2:1626444_at:429:213; Interrogation_Position=1094; Antisense; AAGAGCAGCTCACGCTGGAGCCCTA
>probe:Drosophila_2:1626444_at:73:671; Interrogation_Position=1117; Antisense; TACGAGCGAGACCACGCCGTTGTCG
>probe:Drosophila_2:1626444_at:228:131; Interrogation_Position=1158; Antisense; ACCGCCCAAGCAGTAAGAAGTCGTT
>probe:Drosophila_2:1626444_at:223:371; Interrogation_Position=1174; Antisense; GAAGTCGTTTTCTGCTGGGTTTAGT
>probe:Drosophila_2:1626444_at:548:589; Interrogation_Position=770; Antisense; TGGTCTACGCCGTGGAGTTCTCACA
>probe:Drosophila_2:1626444_at:521:635; Interrogation_Position=804; Antisense; TCGCGATCTGATCAACGTGGCCAAG
>probe:Drosophila_2:1626444_at:233:37; Interrogation_Position=841; Antisense; ATCATACCCATCATCGAGGACGCTC
>probe:Drosophila_2:1626444_at:301:161; Interrogation_Position=875; Antisense; ACAAGTACCGCATGCTGGTGGGCAT
>probe:Drosophila_2:1626444_at:570:35; Interrogation_Position=935; Antisense; ATCAGGGCCGCATTGTGGCGCTGAA
>probe:Drosophila_2:1626444_at:584:613; Interrogation_Position=956; Antisense; TGAATGCCCAGCACTTCCTGAAGAA
>probe:Drosophila_2:1626444_at:132:107; Interrogation_Position=977; Antisense; AGAACGGCGGACACTTTGTCATCTC
>probe:Drosophila_2:1626444_at:500:727; Interrogation_Position=992; Antisense; TTGTCATCTCGATCAAGGCCTCCTG

Paste this into a BLAST search page for me
AGCCCGAAGCGGTATTCGCTGCCGAGCAGGCGGACAAGCTGAAGCCCCAAAAGAGCAGCTCACGCTGGAGCCCTATACGAGCGAGACCACGCCGTTGTCGACCGCCCAAGCAGTAAGAAGTCGTTGAAGTCGTTTTCTGCTGGGTTTAGTTGGTCTACGCCGTGGAGTTCTCACATCGCGATCTGATCAACGTGGCCAAGATCATACCCATCATCGAGGACGCTCACAAGTACCGCATGCTGGTGGGCATATCAGGGCCGCATTGTGGCGCTGAATGAATGCCCAGCACTTCCTGAAGAAAGAACGGCGGACACTTTGTCATCTCTTGTCATCTCGATCAAGGCCTCCTG

Full Affymetrix probeset data:

Annotations for 1626444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720