Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626446_a_at:

>probe:Drosophila_2:1626446_a_at:114:83; Interrogation_Position=335; Antisense; AGGGCTGCTACGAGGACTTCATTGA
>probe:Drosophila_2:1626446_a_at:470:3; Interrogation_Position=355; Antisense; ATTGAGTGCTTGAAGCTCTACGACA
>probe:Drosophila_2:1626446_a_at:66:109; Interrogation_Position=386; Antisense; AGAACGGCACCATGCTGCTGGCTGA
>probe:Drosophila_2:1626446_a_at:717:301; Interrogation_Position=422; Antisense; CCCTGCTGGCGCTTGGTGAGAGCTT
>probe:Drosophila_2:1626446_a_at:700:587; Interrogation_Position=461; Antisense; TGGAGACCCTGTTCGCTGACTGCAT
>probe:Drosophila_2:1626446_a_at:334:285; Interrogation_Position=476; Antisense; CTGACTGCATGGATCCCGAGGATGA
>probe:Drosophila_2:1626446_a_at:685:443; Interrogation_Position=499; Antisense; GATGAAGGATTTATCCCCTACTCTC
>probe:Drosophila_2:1626446_a_at:445:9; Interrogation_Position=525; Antisense; ATTCCTCGCCAGAATGTGTGACAGA
>probe:Drosophila_2:1626446_a_at:90:517; Interrogation_Position=540; Antisense; GTGTGACAGACCAGATCAGCTAAAA
>probe:Drosophila_2:1626446_a_at:453:701; Interrogation_Position=633; Antisense; TTTTAGCGACAACCATTCTCCATAG
>probe:Drosophila_2:1626446_a_at:696:689; Interrogation_Position=664; Antisense; TATTCATCGCTAACTCTCTCTATCT
>probe:Drosophila_2:1626446_a_at:299:281; Interrogation_Position=679; Antisense; CTCTCTATCTCTCTCGTATATTATT
>probe:Drosophila_2:1626446_a_at:545:185; Interrogation_Position=711; Antisense; AAAATTACTTCTGCTACTACAACTG
>probe:Drosophila_2:1626446_a_at:213:615; Interrogation_Position=852; Antisense; TGAATTATTTTGTTGGTTCAGCCAA

Paste this into a BLAST search page for me
AGGGCTGCTACGAGGACTTCATTGAATTGAGTGCTTGAAGCTCTACGACAAGAACGGCACCATGCTGCTGGCTGACCCTGCTGGCGCTTGGTGAGAGCTTTGGAGACCCTGTTCGCTGACTGCATCTGACTGCATGGATCCCGAGGATGAGATGAAGGATTTATCCCCTACTCTCATTCCTCGCCAGAATGTGTGACAGAGTGTGACAGACCAGATCAGCTAAAATTTTAGCGACAACCATTCTCCATAGTATTCATCGCTAACTCTCTCTATCTCTCTCTATCTCTCTCGTATATTATTAAAATTACTTCTGCTACTACAACTGTGAATTATTTTGTTGGTTCAGCCAA

Full Affymetrix probeset data:

Annotations for 1626446_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime