FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626447_at:

>probe:Drosophila_2:1626447_at:728:647; Interrogation_Position=1014; Antisense; TCATCCATCGCGAGGAGGCCAGCTT
>probe:Drosophila_2:1626447_at:607:263; Interrogation_Position=1033; Antisense; CAGCTTTCGAAAGTCGTGCTCGCAC
>probe:Drosophila_2:1626447_at:301:293; Interrogation_Position=1064; Antisense; CGATTCACTGAAGTATGCCCGCTAA
>probe:Drosophila_2:1626447_at:101:13; Interrogation_Position=636; Antisense; ATTCTTCCATCGATCAATGTCACCA
>probe:Drosophila_2:1626447_at:249:137; Interrogation_Position=669; Antisense; ACGTTCACCACCCAGATCATTTTGG
>probe:Drosophila_2:1626447_at:348:37; Interrogation_Position=684; Antisense; ATCATTTTGGCACAGGCTACGCCCA
>probe:Drosophila_2:1626447_at:367:55; Interrogation_Position=732; Antisense; ATGAAGCTGGAGACCCATCTGTCAT
>probe:Drosophila_2:1626447_at:398:271; Interrogation_Position=747; Antisense; CATCTGTCATCCATCTCTAGTGCTT
>probe:Drosophila_2:1626447_at:567:679; Interrogation_Position=764; Antisense; TAGTGCTTCCTCATCGCATTCATAT
>probe:Drosophila_2:1626447_at:639:311; Interrogation_Position=858; Antisense; GCCAAGAGCGGCCATAACCATTTTG
>probe:Drosophila_2:1626447_at:429:203; Interrogation_Position=873; Antisense; AACCATTTTGGCCACCAGAGCGATA
>probe:Drosophila_2:1626447_at:551:29; Interrogation_Position=901; Antisense; ATAACTACAGCATCGACGGCTACCT
>probe:Drosophila_2:1626447_at:10:69; Interrogation_Position=928; Antisense; ATGGCTCCTCAAATGCTAGCTCCTA
>probe:Drosophila_2:1626447_at:723:31; Interrogation_Position=968; Antisense; ATCAATGACGTCCTCATCGCTGGTC

Paste this into a BLAST search page for me
TCATCCATCGCGAGGAGGCCAGCTTCAGCTTTCGAAAGTCGTGCTCGCACCGATTCACTGAAGTATGCCCGCTAAATTCTTCCATCGATCAATGTCACCAACGTTCACCACCCAGATCATTTTGGATCATTTTGGCACAGGCTACGCCCAATGAAGCTGGAGACCCATCTGTCATCATCTGTCATCCATCTCTAGTGCTTTAGTGCTTCCTCATCGCATTCATATGCCAAGAGCGGCCATAACCATTTTGAACCATTTTGGCCACCAGAGCGATAATAACTACAGCATCGACGGCTACCTATGGCTCCTCAAATGCTAGCTCCTAATCAATGACGTCCTCATCGCTGGTC

Full Affymetrix probeset data:

Annotations for 1626447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720