Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626448_at:

>probe:Drosophila_2:1626448_at:267:319; Interrogation_Position=2911; Antisense; GCCGTATCCCGTTGGTTACATGAAC
>probe:Drosophila_2:1626448_at:53:635; Interrogation_Position=2942; Antisense; TCGCCATCGACTTATTCACCGAATA
>probe:Drosophila_2:1626448_at:680:365; Interrogation_Position=2962; Antisense; GAATACTCCTGGTGGCATACCGCAG
>probe:Drosophila_2:1626448_at:272:267; Interrogation_Position=3016; Antisense; CAGTCTGGACTCGTCGATGGGCGAC
>probe:Drosophila_2:1626448_at:19:525; Interrogation_Position=3034; Antisense; GGGCGACTGGTGTACCACAGACATT
>probe:Drosophila_2:1626448_at:165:615; Interrogation_Position=3058; Antisense; TGAAGTTCGGATTCACACGCACGAC
>probe:Drosophila_2:1626448_at:310:409; Interrogation_Position=3080; Antisense; GACGACACCGATCTCGTTGGGCAAA
>probe:Drosophila_2:1626448_at:631:43; Interrogation_Position=3162; Antisense; ATCGCAGTGTGTCCATCGTTAGTGA
>probe:Drosophila_2:1626448_at:99:41; Interrogation_Position=3176; Antisense; ATCGTTAGTGAGCACTTGGCGCCAG
>probe:Drosophila_2:1626448_at:146:729; Interrogation_Position=3191; Antisense; TTGGCGCCAGTGCTACCATGCAATG
>probe:Drosophila_2:1626448_at:264:87; Interrogation_Position=3252; Antisense; AGTCCGTGGGCAGAGTGCTGTCCAA
>probe:Drosophila_2:1626448_at:436:327; Interrogation_Position=3282; Antisense; GCGATGTGTTCGTCTGCAGGATTAA
>probe:Drosophila_2:1626448_at:323:673; Interrogation_Position=3324; Antisense; TACCGATTAACTTCCTCTGCAAGAT
>probe:Drosophila_2:1626448_at:500:87; Interrogation_Position=3351; Antisense; AGTCCATCGACTAAGCTCTACATAC

Paste this into a BLAST search page for me
GCCGTATCCCGTTGGTTACATGAACTCGCCATCGACTTATTCACCGAATAGAATACTCCTGGTGGCATACCGCAGCAGTCTGGACTCGTCGATGGGCGACGGGCGACTGGTGTACCACAGACATTTGAAGTTCGGATTCACACGCACGACGACGACACCGATCTCGTTGGGCAAAATCGCAGTGTGTCCATCGTTAGTGAATCGTTAGTGAGCACTTGGCGCCAGTTGGCGCCAGTGCTACCATGCAATGAGTCCGTGGGCAGAGTGCTGTCCAAGCGATGTGTTCGTCTGCAGGATTAATACCGATTAACTTCCTCTGCAAGATAGTCCATCGACTAAGCTCTACATAC

Full Affymetrix probeset data:

Annotations for 1626448_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime