FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626451_at:

>probe:Drosophila_2:1626451_at:504:127; Interrogation_Position=2047; Antisense; ACCACGATTGTTAGCCAGCAGCCTG
>probe:Drosophila_2:1626451_at:648:277; Interrogation_Position=2074; Antisense; CTCAATTCCAATCCCAGTCTGGAGA
>probe:Drosophila_2:1626451_at:180:265; Interrogation_Position=2101; Antisense; CAGAACTTCTACAGGCAGCACTTGA
>probe:Drosophila_2:1626451_at:7:113; Interrogation_Position=2117; Antisense; AGCACTTGACGCCACAGTTGAGCAA
>probe:Drosophila_2:1626451_at:271:175; Interrogation_Position=2212; Antisense; AAAGCCAGCGGCGACATTAGTCCAG
>probe:Drosophila_2:1626451_at:178:13; Interrogation_Position=2227; Antisense; ATTAGTCCAGCTCTCAACCATGGGA
>probe:Drosophila_2:1626451_at:43:203; Interrogation_Position=2242; Antisense; AACCATGGGATACCGCAGTTCGCCT
>probe:Drosophila_2:1626451_at:306:93; Interrogation_Position=2258; Antisense; AGTTCGCCTCACAAAACCTGCACTT
>probe:Drosophila_2:1626451_at:545:523; Interrogation_Position=2288; Antisense; GGGCCTTTTGAGCACTTGCACCACC
>probe:Drosophila_2:1626451_at:587:589; Interrogation_Position=2385; Antisense; TGAGTCCTTTTTACCCAGAAACAAG
>probe:Drosophila_2:1626451_at:459:107; Interrogation_Position=2401; Antisense; AGAAACAAGTATCTACCGCCCTACA
>probe:Drosophila_2:1626451_at:68:3; Interrogation_Position=2418; Antisense; GCCCTACACGTTGACTTAAGTTTTG
>probe:Drosophila_2:1626451_at:472:655; Interrogation_Position=2434; Antisense; TAAGTTTTGCGTACAACATCTTTGT
>probe:Drosophila_2:1626451_at:141:653; Interrogation_Position=2476; Antisense; TAAAGCGTAAGCATCGACCTAAGAA

Paste this into a BLAST search page for me
ACCACGATTGTTAGCCAGCAGCCTGCTCAATTCCAATCCCAGTCTGGAGACAGAACTTCTACAGGCAGCACTTGAAGCACTTGACGCCACAGTTGAGCAAAAAGCCAGCGGCGACATTAGTCCAGATTAGTCCAGCTCTCAACCATGGGAAACCATGGGATACCGCAGTTCGCCTAGTTCGCCTCACAAAACCTGCACTTGGGCCTTTTGAGCACTTGCACCACCTGAGTCCTTTTTACCCAGAAACAAGAGAAACAAGTATCTACCGCCCTACAGCCCTACACGTTGACTTAAGTTTTGTAAGTTTTGCGTACAACATCTTTGTTAAAGCGTAAGCATCGACCTAAGAA

Full Affymetrix probeset data:

Annotations for 1626451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720