Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626452_at:

>probe:Drosophila_2:1626452_at:480:587; Interrogation_Position=1343; Antisense; TGGAGCGCATTGGACGGGTCACTCT
>probe:Drosophila_2:1626452_at:521:259; Interrogation_Position=1404; Antisense; CACCTACATGTACACCTGGGAAGCG
>probe:Drosophila_2:1626452_at:172:685; Interrogation_Position=1441; Antisense; TATATGAGCTACTGCACCTTTGCGG
>probe:Drosophila_2:1626452_at:265:89; Interrogation_Position=1488; Antisense; AGTCTGGCTGGTTGTGGTCAATGCT
>probe:Drosophila_2:1626452_at:231:701; Interrogation_Position=1513; Antisense; TTTTATGGCATTCTGTTTCCGAACC
>probe:Drosophila_2:1626452_at:28:381; Interrogation_Position=1533; Antisense; GAACCATCTGATTGCCGCTTATAGC
>probe:Drosophila_2:1626452_at:339:703; Interrogation_Position=1551; Antisense; TTATAGCAACTTCCGCCTGTGGGAA
>probe:Drosophila_2:1626452_at:472:139; Interrogation_Position=1579; Antisense; ACTGGTTCTGTTATCGGCTACGTCA
>probe:Drosophila_2:1626452_at:484:671; Interrogation_Position=1597; Antisense; TACGTCATCAGTTCGCAGCTTTGCA
>probe:Drosophila_2:1626452_at:184:117; Interrogation_Position=1613; Antisense; AGCTTTGCACCTCCACGAAATTGGT
>probe:Drosophila_2:1626452_at:290:469; Interrogation_Position=1664; Antisense; GTTGCGTGGGATATGGCCTCATCGA
>probe:Drosophila_2:1626452_at:352:269; Interrogation_Position=1683; Antisense; CATCGAGTACCGCTTTTGGCAGAAG
>probe:Drosophila_2:1626452_at:267:433; Interrogation_Position=1731; Antisense; GAGTGACTGATTAGCTCTTCAAGGC
>probe:Drosophila_2:1626452_at:308:571; Interrogation_Position=1753; Antisense; GGCTAATTCCATATCTTGCCATTTT

Paste this into a BLAST search page for me
TGGAGCGCATTGGACGGGTCACTCTCACCTACATGTACACCTGGGAAGCGTATATGAGCTACTGCACCTTTGCGGAGTCTGGCTGGTTGTGGTCAATGCTTTTTATGGCATTCTGTTTCCGAACCGAACCATCTGATTGCCGCTTATAGCTTATAGCAACTTCCGCCTGTGGGAAACTGGTTCTGTTATCGGCTACGTCATACGTCATCAGTTCGCAGCTTTGCAAGCTTTGCACCTCCACGAAATTGGTGTTGCGTGGGATATGGCCTCATCGACATCGAGTACCGCTTTTGGCAGAAGGAGTGACTGATTAGCTCTTCAAGGCGGCTAATTCCATATCTTGCCATTTT

Full Affymetrix probeset data:

Annotations for 1626452_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime