Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626454_at:

>probe:Drosophila_2:1626454_at:554:455; Interrogation_Position=1993; Antisense; GATACGGAACAAGTACTCGCACAAA
>probe:Drosophila_2:1626454_at:729:79; Interrogation_Position=2037; Antisense; AGGTGCCGCTGCTGACGAACCAGGA
>probe:Drosophila_2:1626454_at:619:379; Interrogation_Position=2053; Antisense; GAACCAGGAGCTCTTCCAGGGCAAC
>probe:Drosophila_2:1626454_at:254:525; Interrogation_Position=2071; Antisense; GGGCAACCTTGACCTGAACGAAAGC
>probe:Drosophila_2:1626454_at:47:559; Interrogation_Position=2107; Antisense; GGACAGCCTCAAAGTTTAGCCAAAT
>probe:Drosophila_2:1626454_at:260:457; Interrogation_Position=2139; Antisense; GATACGATACGCTTCACTTAGGCTC
>probe:Drosophila_2:1626454_at:76:705; Interrogation_Position=2156; Antisense; TTAGGCTCTAAGACGCTTCTATTCC
>probe:Drosophila_2:1626454_at:106:409; Interrogation_Position=2167; Antisense; GACGCTTCTATTCCCAATATTAGCC
>probe:Drosophila_2:1626454_at:631:703; Interrogation_Position=2249; Antisense; TTACCTAGTGTTCCCGTCAAGTCCT
>probe:Drosophila_2:1626454_at:679:493; Interrogation_Position=2264; Antisense; GTCAAGTCCTCGCAATTTATTATAT
>probe:Drosophila_2:1626454_at:106:513; Interrogation_Position=2302; Antisense; GTGACCTTCGCATTATTGACATGTT
>probe:Drosophila_2:1626454_at:650:477; Interrogation_Position=2382; Antisense; GTTTAATTTTCCCACATACCGCATA
>probe:Drosophila_2:1626454_at:111:671; Interrogation_Position=2398; Antisense; TACCGCATACGTAGCCGAACACAAT
>probe:Drosophila_2:1626454_at:440:225; Interrogation_Position=2437; Antisense; AAGGCGACATTATCTTTAGCACCCC

Paste this into a BLAST search page for me
GATACGGAACAAGTACTCGCACAAAAGGTGCCGCTGCTGACGAACCAGGAGAACCAGGAGCTCTTCCAGGGCAACGGGCAACCTTGACCTGAACGAAAGCGGACAGCCTCAAAGTTTAGCCAAATGATACGATACGCTTCACTTAGGCTCTTAGGCTCTAAGACGCTTCTATTCCGACGCTTCTATTCCCAATATTAGCCTTACCTAGTGTTCCCGTCAAGTCCTGTCAAGTCCTCGCAATTTATTATATGTGACCTTCGCATTATTGACATGTTGTTTAATTTTCCCACATACCGCATATACCGCATACGTAGCCGAACACAATAAGGCGACATTATCTTTAGCACCCC

Full Affymetrix probeset data:

Annotations for 1626454_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime