Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626455_s_at:

>probe:Drosophila_2:1626455_s_at:654:193; Interrogation_Position=171; Antisense; AACTGTTTCGAGTCTGGGCAACACC
>probe:Drosophila_2:1626455_s_at:667:245; Interrogation_Position=195; Antisense; CAAGAAGTGTTTTGCTCGTTACCTA
>probe:Drosophila_2:1626455_s_at:551:579; Interrogation_Position=207; Antisense; TGCTCGTTACCTACCGGAACTGGAA
>probe:Drosophila_2:1626455_s_at:277:525; Interrogation_Position=239; Antisense; GGGCTACCTGGTCGCAAGGATATAA
>probe:Drosophila_2:1626455_s_at:522:13; Interrogation_Position=277; Antisense; ATTACCATTAACGAGCGGCTGTCCT
>probe:Drosophila_2:1626455_s_at:701:597; Interrogation_Position=296; Antisense; TGTCCTTGCTAACGGATGCCACTGA
>probe:Drosophila_2:1626455_s_at:575:625; Interrogation_Position=345; Antisense; TGCCCTGGGCATATCATCATTTATT
>probe:Drosophila_2:1626455_s_at:659:35; Interrogation_Position=371; Antisense; ATCAGTGTTTGGTCCTGACGGAGGC
>probe:Drosophila_2:1626455_s_at:226:557; Interrogation_Position=399; Antisense; GGACTTTTTCAACTGCTTTGCCAAA
>probe:Drosophila_2:1626455_s_at:20:475; Interrogation_Position=432; Antisense; GTTACAGTTGGCGAATGTCTACAGT
>probe:Drosophila_2:1626455_s_at:61:699; Interrogation_Position=463; Antisense; TTTAATGCCACCGAGCAGGCTTTAA
>probe:Drosophila_2:1626455_s_at:435:363; Interrogation_Position=514; Antisense; GAATTGGAGCACTATCGCTGCACAA
>probe:Drosophila_2:1626455_s_at:647:561; Interrogation_Position=565; Antisense; GGAACCAATACAATCTTTCGATCTT
>probe:Drosophila_2:1626455_s_at:7:453; Interrogation_Position=584; Antisense; GATCTTTGGATCAGTGTCTGCAGCA

Paste this into a BLAST search page for me
AACTGTTTCGAGTCTGGGCAACACCCAAGAAGTGTTTTGCTCGTTACCTATGCTCGTTACCTACCGGAACTGGAAGGGCTACCTGGTCGCAAGGATATAAATTACCATTAACGAGCGGCTGTCCTTGTCCTTGCTAACGGATGCCACTGATGCCCTGGGCATATCATCATTTATTATCAGTGTTTGGTCCTGACGGAGGCGGACTTTTTCAACTGCTTTGCCAAAGTTACAGTTGGCGAATGTCTACAGTTTTAATGCCACCGAGCAGGCTTTAAGAATTGGAGCACTATCGCTGCACAAGGAACCAATACAATCTTTCGATCTTGATCTTTGGATCAGTGTCTGCAGCA

Full Affymetrix probeset data:

Annotations for 1626455_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime