FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626456_at:

>probe:Drosophila_2:1626456_at:400:223; Interrogation_Position=1047; Antisense; AAGGTCAAGCGTTCCGCTGGCGATG
>probe:Drosophila_2:1626456_at:647:165; Interrogation_Position=1081; Antisense; AAATCCGCTCAAGACTGCACATATC
>probe:Drosophila_2:1626456_at:110:181; Interrogation_Position=1108; Antisense; AAACACCATCGAAAGCGGTAGCCAT
>probe:Drosophila_2:1626456_at:431:539; Interrogation_Position=1124; Antisense; GGTAGCCATAACATCGGCTGCCGAA
>probe:Drosophila_2:1626456_at:361:553; Interrogation_Position=1149; Antisense; GGAGCAGTAACAGCAAGATCCCACT
>probe:Drosophila_2:1626456_at:43:305; Interrogation_Position=1179; Antisense; CCGTCATTTTCATCCTGTAGGGAGA
>probe:Drosophila_2:1626456_at:657:489; Interrogation_Position=1235; Antisense; GTACATCATGTTCGATCATTTCTAA
>probe:Drosophila_2:1626456_at:668:347; Interrogation_Position=1314; Antisense; GAATACCGAACCAACGTTTTCACAG
>probe:Drosophila_2:1626456_at:63:613; Interrogation_Position=1362; Antisense; TGAAATGCCCACAACTGCACATACT
>probe:Drosophila_2:1626456_at:729:39; Interrogation_Position=813; Antisense; ATCGGACAGCAATATCTGCTCGGCA
>probe:Drosophila_2:1626456_at:49:41; Interrogation_Position=826; Antisense; ATCTGCTCGGCAGCTCTGGCAAGAG
>probe:Drosophila_2:1626456_at:282:207; Interrogation_Position=852; Antisense; AAGCGTGCCGCTGCCAAGAAGGTGA
>probe:Drosophila_2:1626456_at:440:223; Interrogation_Position=870; Antisense; AAGGTGATCGAAACCGGCACGGCCA
>probe:Drosophila_2:1626456_at:392:269; Interrogation_Position=905; Antisense; CATCGACTACGATTGGGTGCCACAG

Paste this into a BLAST search page for me
AAGGTCAAGCGTTCCGCTGGCGATGAAATCCGCTCAAGACTGCACATATCAAACACCATCGAAAGCGGTAGCCATGGTAGCCATAACATCGGCTGCCGAAGGAGCAGTAACAGCAAGATCCCACTCCGTCATTTTCATCCTGTAGGGAGAGTACATCATGTTCGATCATTTCTAAGAATACCGAACCAACGTTTTCACAGTGAAATGCCCACAACTGCACATACTATCGGACAGCAATATCTGCTCGGCAATCTGCTCGGCAGCTCTGGCAAGAGAAGCGTGCCGCTGCCAAGAAGGTGAAAGGTGATCGAAACCGGCACGGCCACATCGACTACGATTGGGTGCCACAG

Full Affymetrix probeset data:

Annotations for 1626456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720