FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626458_at:

>probe:Drosophila_2:1626458_at:164:121; Interrogation_Position=1015; Antisense; AGCTGTGTGCTCTTTATGGATCCCA
>probe:Drosophila_2:1626458_at:78:635; Interrogation_Position=1048; Antisense; TCGCTACTCTTCGATAAGCCCAATA
>probe:Drosophila_2:1626458_at:171:187; Interrogation_Position=1072; Antisense; AACACTAGGGATGTGGCCTTTCTGG
>probe:Drosophila_2:1626458_at:669:51; Interrogation_Position=1106; Antisense; ATGCTGGCGTAATGGCTCTGGCCAA
>probe:Drosophila_2:1626458_at:230:411; Interrogation_Position=1228; Antisense; GAGAAACCGCAATCGGACCCGGATA
>probe:Drosophila_2:1626458_at:493:547; Interrogation_Position=1281; Antisense; GGATGCTTCGCTTTAGACCCTAAGA
>probe:Drosophila_2:1626458_at:304:129; Interrogation_Position=822; Antisense; ACCAGACATTGTTTTCTTTGGCGAA
>probe:Drosophila_2:1626458_at:81:429; Interrogation_Position=858; Antisense; GAGATTTTACTCCAGTCCTGAAGAG
>probe:Drosophila_2:1626458_at:655:459; Interrogation_Position=883; Antisense; GATTTCCAGGATTGCGATCTGCTGA
>probe:Drosophila_2:1626458_at:556:621; Interrogation_Position=902; Antisense; TGCTGATCATCATGGGCACATCGTT
>probe:Drosophila_2:1626458_at:23:203; Interrogation_Position=935; Antisense; AACCGTTTGCTTCACTGGTGTGGAG
>probe:Drosophila_2:1626458_at:429:551; Interrogation_Position=956; Antisense; GGAGACCAGGACCACGTTGCATTCG
>probe:Drosophila_2:1626458_at:533:469; Interrogation_Position=971; Antisense; GTTGCATTCGCCTCTTGATCAATCG
>probe:Drosophila_2:1626458_at:140:237; Interrogation_Position=991; Antisense; AATCGCGATGCAGTGGGTCAGGCCA

Paste this into a BLAST search page for me
AGCTGTGTGCTCTTTATGGATCCCATCGCTACTCTTCGATAAGCCCAATAAACACTAGGGATGTGGCCTTTCTGGATGCTGGCGTAATGGCTCTGGCCAAGAGAAACCGCAATCGGACCCGGATAGGATGCTTCGCTTTAGACCCTAAGAACCAGACATTGTTTTCTTTGGCGAAGAGATTTTACTCCAGTCCTGAAGAGGATTTCCAGGATTGCGATCTGCTGATGCTGATCATCATGGGCACATCGTTAACCGTTTGCTTCACTGGTGTGGAGGGAGACCAGGACCACGTTGCATTCGGTTGCATTCGCCTCTTGATCAATCGAATCGCGATGCAGTGGGTCAGGCCA

Full Affymetrix probeset data:

Annotations for 1626458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720