FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626460_at:

>probe:Drosophila_2:1626460_at:501:603; Interrogation_Position=2454; Antisense; TGATTGACAACGAGGCGCGGCATGT
>probe:Drosophila_2:1626460_at:73:583; Interrogation_Position=2481; Antisense; TGGCGAGTGCTTACCAAACCACCGA
>probe:Drosophila_2:1626460_at:192:435; Interrogation_Position=2504; Antisense; GAGGGCATACTCACTACGCATCGCG
>probe:Drosophila_2:1626460_at:65:109; Interrogation_Position=2538; Antisense; AGAAGCTGGCCGAAGCTCTGCTGGA
>probe:Drosophila_2:1626460_at:688:125; Interrogation_Position=2583; Antisense; ACCAGGTGGTGCAGCTAATCGGACC
>probe:Drosophila_2:1626460_at:61:377; Interrogation_Position=2665; Antisense; GAAGAACCTAAGCACCGACACGGAT
>probe:Drosophila_2:1626460_at:427:395; Interrogation_Position=2681; Antisense; GACACGGATGCCACAAAAGCCTGAG
>probe:Drosophila_2:1626460_at:327:173; Interrogation_Position=2696; Antisense; AAAGCCTGAGGCCATGGGTCCAACT
>probe:Drosophila_2:1626460_at:462:531; Interrogation_Position=2711; Antisense; GGGTCCAACTCAGATCGCAAGTCAT
>probe:Drosophila_2:1626460_at:434:647; Interrogation_Position=2732; Antisense; TCATAGCCATAGTCTTCGTACGCCA
>probe:Drosophila_2:1626460_at:639:299; Interrogation_Position=2788; Antisense; CCCTGGCTCATGTGCGTTGAATGTA
>probe:Drosophila_2:1626460_at:548:467; Interrogation_Position=2819; Antisense; GTTGTTTACCTTTCTACATGACTCC
>probe:Drosophila_2:1626460_at:423:143; Interrogation_Position=2839; Antisense; ACTCCCGATCGGTGTTCATTAACTA
>probe:Drosophila_2:1626460_at:56:255; Interrogation_Position=2938; Antisense; CACTAATTGTCACGTCCCGGAAATG

Paste this into a BLAST search page for me
TGATTGACAACGAGGCGCGGCATGTTGGCGAGTGCTTACCAAACCACCGAGAGGGCATACTCACTACGCATCGCGAGAAGCTGGCCGAAGCTCTGCTGGAACCAGGTGGTGCAGCTAATCGGACCGAAGAACCTAAGCACCGACACGGATGACACGGATGCCACAAAAGCCTGAGAAAGCCTGAGGCCATGGGTCCAACTGGGTCCAACTCAGATCGCAAGTCATTCATAGCCATAGTCTTCGTACGCCACCCTGGCTCATGTGCGTTGAATGTAGTTGTTTACCTTTCTACATGACTCCACTCCCGATCGGTGTTCATTAACTACACTAATTGTCACGTCCCGGAAATG

Full Affymetrix probeset data:

Annotations for 1626460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720