Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626461_at:

>probe:Drosophila_2:1626461_at:120:721; Interrogation_Position=3322; Antisense; TTGCCCTACATCATCAGTACGCGGC
>probe:Drosophila_2:1626461_at:612:353; Interrogation_Position=3347; Antisense; GCACCTGGCAATCCTGCAAATTGAG
>probe:Drosophila_2:1626461_at:653:247; Interrogation_Position=3365; Antisense; AATTGAGAGTTTACGCGCTGGCTAA
>probe:Drosophila_2:1626461_at:599:295; Interrogation_Position=3411; Antisense; CGAGCAGCGCTCAATGGCCAGTTTG
>probe:Drosophila_2:1626461_at:492:311; Interrogation_Position=3427; Antisense; GCCAGTTTGCTGTCGAAATTCCGGA
>probe:Drosophila_2:1626461_at:186:73; Interrogation_Position=3500; Antisense; AGGAAACATCCACGCAGTTCTTTAA
>probe:Drosophila_2:1626461_at:78:115; Interrogation_Position=3577; Antisense; AGCAGCAGGGCAACTCTCAACGAGG
>probe:Drosophila_2:1626461_at:433:447; Interrogation_Position=3604; Antisense; GATGCCCTCATAACCGACGATGATC
>probe:Drosophila_2:1626461_at:530:103; Interrogation_Position=3647; Antisense; AGACGAATCGGTATTTGCGGCTGCG
>probe:Drosophila_2:1626461_at:247:91; Interrogation_Position=3674; Antisense; AGTACCTGCGGGAGCAGTCGACCAA
>probe:Drosophila_2:1626461_at:572:217; Interrogation_Position=3697; Antisense; AAGTCGGACCTCGTGGTGATGACCC
>probe:Drosophila_2:1626461_at:254:611; Interrogation_Position=3716; Antisense; TGACCCTGCCGATGCCACGGAAGAA
>probe:Drosophila_2:1626461_at:168:727; Interrogation_Position=3809; Antisense; TTGTGCGCGGCAATCAGACGAGTGT
>probe:Drosophila_2:1626461_at:248:105; Interrogation_Position=3824; Antisense; AGACGAGTGTGCTGACCTTCTACTC

Paste this into a BLAST search page for me
TTGCCCTACATCATCAGTACGCGGCGCACCTGGCAATCCTGCAAATTGAGAATTGAGAGTTTACGCGCTGGCTAACGAGCAGCGCTCAATGGCCAGTTTGGCCAGTTTGCTGTCGAAATTCCGGAAGGAAACATCCACGCAGTTCTTTAAAGCAGCAGGGCAACTCTCAACGAGGGATGCCCTCATAACCGACGATGATCAGACGAATCGGTATTTGCGGCTGCGAGTACCTGCGGGAGCAGTCGACCAAAAGTCGGACCTCGTGGTGATGACCCTGACCCTGCCGATGCCACGGAAGAATTGTGCGCGGCAATCAGACGAGTGTAGACGAGTGTGCTGACCTTCTACTC

Full Affymetrix probeset data:

Annotations for 1626461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime