FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626462_at:

>probe:Drosophila_2:1626462_at:689:435; Interrogation_Position=274; Antisense; GAGGAGCGACTAGGCATCCAACTGA
>probe:Drosophila_2:1626462_at:98:269; Interrogation_Position=288; Antisense; CATCCAACTGATGAGTGTCCTACCA
>probe:Drosophila_2:1626462_at:581:31; Interrogation_Position=313; Antisense; ATAACGGAAAGCTCTCTGCTCAGTC
>probe:Drosophila_2:1626462_at:65:641; Interrogation_Position=327; Antisense; TCTGCTCAGTCATACCATCTGGGAG
>probe:Drosophila_2:1626462_at:182:219; Interrogation_Position=406; Antisense; AAGGTTGGCATCATTACGGTCACGG
>probe:Drosophila_2:1626462_at:69:141; Interrogation_Position=421; Antisense; ACGGTCACGGCTGAGTCCAAGCAAA
>probe:Drosophila_2:1626462_at:232:375; Interrogation_Position=600; Antisense; GAAGTTCGATCATTCCTGGATGCTG
>probe:Drosophila_2:1626462_at:64:53; Interrogation_Position=619; Antisense; ATGCTGACTGCACACACAAGGACGC
>probe:Drosophila_2:1626462_at:79:613; Interrogation_Position=651; Antisense; TGAAAAGCCCTTTGTGTGTCCTGAT
>probe:Drosophila_2:1626462_at:115:89; Interrogation_Position=679; Antisense; AGTTGCCGCAAAGCCTTTTCGGATA
>probe:Drosophila_2:1626462_at:398:699; Interrogation_Position=694; Antisense; TTTTCGGATAGGTCCAATCTGCGCT
>probe:Drosophila_2:1626462_at:349:519; Interrogation_Position=770; Antisense; GTGGCAAGTATTTCAGTCAGTTTTC
>probe:Drosophila_2:1626462_at:600:367; Interrogation_Position=801; Antisense; GAATCGACACTCGTTGGACGCTTGT
>probe:Drosophila_2:1626462_at:179:503; Interrogation_Position=824; Antisense; GTCGCAAGTATCTGCTGTCCGTGAT

Paste this into a BLAST search page for me
GAGGAGCGACTAGGCATCCAACTGACATCCAACTGATGAGTGTCCTACCAATAACGGAAAGCTCTCTGCTCAGTCTCTGCTCAGTCATACCATCTGGGAGAAGGTTGGCATCATTACGGTCACGGACGGTCACGGCTGAGTCCAAGCAAAGAAGTTCGATCATTCCTGGATGCTGATGCTGACTGCACACACAAGGACGCTGAAAAGCCCTTTGTGTGTCCTGATAGTTGCCGCAAAGCCTTTTCGGATATTTTCGGATAGGTCCAATCTGCGCTGTGGCAAGTATTTCAGTCAGTTTTCGAATCGACACTCGTTGGACGCTTGTGTCGCAAGTATCTGCTGTCCGTGAT

Full Affymetrix probeset data:

Annotations for 1626462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720