FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626466_at:

>probe:Drosophila_2:1626466_at:60:539; Interrogation_Position=173; Antisense; GGTCAAAGTTTGATCTCTCCCACAA
>probe:Drosophila_2:1626466_at:409:469; Interrogation_Position=234; Antisense; GTTCTTCTTGGCTGGATTCGAGACC
>probe:Drosophila_2:1626466_at:406:631; Interrogation_Position=259; Antisense; TCCTCCAGTACGATGAGCTCTTGTA
>probe:Drosophila_2:1626466_at:363:699; Interrogation_Position=279; Antisense; TTGTAAGTACGAACTAGCCCTCCAG
>probe:Drosophila_2:1626466_at:225:461; Interrogation_Position=360; Antisense; GATTACTTACGACGCCTTAGCTAAA
>probe:Drosophila_2:1626466_at:721:105; Interrogation_Position=396; Antisense; AGAACAGGTCTTGTCTGCTCATCGT
>probe:Drosophila_2:1626466_at:493:527; Interrogation_Position=427; Antisense; GGGAACTTCATTACTGATACCTGTG
>probe:Drosophila_2:1626466_at:272:603; Interrogation_Position=457; Antisense; TGTTCACTACGATCCGCACTTATAT
>probe:Drosophila_2:1626466_at:32:705; Interrogation_Position=476; Antisense; TTATATCCACATCCAAAACTCTTCG
>probe:Drosophila_2:1626466_at:675:21; Interrogation_Position=550; Antisense; ATATCTGCCCTTCGGAACATTTGGA
>probe:Drosophila_2:1626466_at:607:5; Interrogation_Position=568; Antisense; ATTTGGACCCCGCAGTTGCATAGGT
>probe:Drosophila_2:1626466_at:620:343; Interrogation_Position=585; Antisense; GCATAGGTCTGCGTTTTGGCAAAAT
>probe:Drosophila_2:1626466_at:590:95; Interrogation_Position=618; Antisense; AGATTGGCATTGTGTCAGCGCTTCA
>probe:Drosophila_2:1626466_at:378:123; Interrogation_Position=634; Antisense; AGCGCTTCAAGTTCGGTGATTCAGA

Paste this into a BLAST search page for me
GGTCAAAGTTTGATCTCTCCCACAAGTTCTTCTTGGCTGGATTCGAGACCTCCTCCAGTACGATGAGCTCTTGTATTGTAAGTACGAACTAGCCCTCCAGGATTACTTACGACGCCTTAGCTAAAAGAACAGGTCTTGTCTGCTCATCGTGGGAACTTCATTACTGATACCTGTGTGTTCACTACGATCCGCACTTATATTTATATCCACATCCAAAACTCTTCGATATCTGCCCTTCGGAACATTTGGAATTTGGACCCCGCAGTTGCATAGGTGCATAGGTCTGCGTTTTGGCAAAATAGATTGGCATTGTGTCAGCGCTTCAAGCGCTTCAAGTTCGGTGATTCAGA

Full Affymetrix probeset data:

Annotations for 1626466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720