Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626467_a_at:

>probe:Drosophila_2:1626467_a_at:721:69; Interrogation_Position=104; Antisense; AGGCTTTCGATCTCGCCAAGCTGCT
>probe:Drosophila_2:1626467_a_at:415:51; Interrogation_Position=134; Antisense; AGACCGGAACGGAGCCCATCTGGGC
>probe:Drosophila_2:1626467_a_at:534:635; Interrogation_Position=152; Antisense; TCTGGGCGGTAATCGATCGCAACTT
>probe:Drosophila_2:1626467_a_at:360:359; Interrogation_Position=170; Antisense; GCAACTTGCCGCAGGTGCAGGAGCT
>probe:Drosophila_2:1626467_a_at:662:649; Interrogation_Position=197; Antisense; TCACCGCGGCCAGGATGGAGTGCAT
>probe:Drosophila_2:1626467_a_at:154:433; Interrogation_Position=214; Antisense; GAGTGCATCCAGAAGCTGCAGCTGC
>probe:Drosophila_2:1626467_a_at:115:441; Interrogation_Position=327; Antisense; GATGGACGCCGACAACAAGCTGAAC
>probe:Drosophila_2:1626467_a_at:171:353; Interrogation_Position=34; Antisense; GCAGCCATTCCGCTAATGACGATAG
>probe:Drosophila_2:1626467_a_at:37:161; Interrogation_Position=341; Antisense; ACAAGCTGAACGTTGGCCAGGTGGA
>probe:Drosophila_2:1626467_a_at:460:183; Interrogation_Position=394; Antisense; AACAAGATGGCCATCGCCGTTAGCT
>probe:Drosophila_2:1626467_a_at:449:475; Interrogation_Position=412; Antisense; GTTAGCTCCAGCATGGCGCAGGCCT
>probe:Drosophila_2:1626467_a_at:622:55; Interrogation_Position=49; Antisense; ATGACGATAGTGGTCGCTGTCCTGC
>probe:Drosophila_2:1626467_a_at:401:267; Interrogation_Position=490; Antisense; CAGTGCATCAGTCGCCAGCTGGAGC
>probe:Drosophila_2:1626467_a_at:333:359; Interrogation_Position=515; Antisense; GCAACAACGTAAAGCTGGTCTGGTA

Paste this into a BLAST search page for me
AGGCTTTCGATCTCGCCAAGCTGCTAGACCGGAACGGAGCCCATCTGGGCTCTGGGCGGTAATCGATCGCAACTTGCAACTTGCCGCAGGTGCAGGAGCTTCACCGCGGCCAGGATGGAGTGCATGAGTGCATCCAGAAGCTGCAGCTGCGATGGACGCCGACAACAAGCTGAACGCAGCCATTCCGCTAATGACGATAGACAAGCTGAACGTTGGCCAGGTGGAAACAAGATGGCCATCGCCGTTAGCTGTTAGCTCCAGCATGGCGCAGGCCTATGACGATAGTGGTCGCTGTCCTGCCAGTGCATCAGTCGCCAGCTGGAGCGCAACAACGTAAAGCTGGTCTGGTA

Full Affymetrix probeset data:

Annotations for 1626467_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime