FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626469_at:

>probe:Drosophila_2:1626469_at:33:233; Interrogation_Position=1015; Antisense; AATAAACGAAACATCACCGCCTGCA
>probe:Drosophila_2:1626469_at:382:501; Interrogation_Position=504; Antisense; GTCGCCTGGATTTACGCGTGGGCAA
>probe:Drosophila_2:1626469_at:119:597; Interrogation_Position=615; Antisense; TGTCCGGTCTGGTGAAGTTCGTGCC
>probe:Drosophila_2:1626469_at:112:217; Interrogation_Position=629; Antisense; AAGTTCGTGCCCCTGGAAGAGATGC
>probe:Drosophila_2:1626469_at:81:201; Interrogation_Position=656; Antisense; AACCGTCTGGTAGTGGTCATGTGTA
>probe:Drosophila_2:1626469_at:3:497; Interrogation_Position=671; Antisense; GTCATGTGTAACCTGAAGCCGGCCA
>probe:Drosophila_2:1626469_at:184:185; Interrogation_Position=695; Antisense; AAAATGCGCGGCGTCACCTCGGAGG
>probe:Drosophila_2:1626469_at:200:439; Interrogation_Position=716; Antisense; GAGGCTATGGTCATGTGCGCATCTA
>probe:Drosophila_2:1626469_at:135:647; Interrogation_Position=726; Antisense; TCATGTGCGCATCTACACCGGAAAA
>probe:Drosophila_2:1626469_at:203:169; Interrogation_Position=749; Antisense; AAAGTGGAAGTGCTCAGTCCGCCCG
>probe:Drosophila_2:1626469_at:445:413; Interrogation_Position=791; Antisense; GACCTGGTTCACTGCGAGGGCTATC
>probe:Drosophila_2:1626469_at:508:371; Interrogation_Position=850; Antisense; GAAGATCTTTGAGTCGTGCGCCCCG
>probe:Drosophila_2:1626469_at:501:537; Interrogation_Position=874; Antisense; GGATCTGAAGACCAACGGCGAACTG
>probe:Drosophila_2:1626469_at:59:197; Interrogation_Position=894; Antisense; AACTGGTTGCCTGCTACAAGGGCGC

Paste this into a BLAST search page for me
AATAAACGAAACATCACCGCCTGCAGTCGCCTGGATTTACGCGTGGGCAATGTCCGGTCTGGTGAAGTTCGTGCCAAGTTCGTGCCCCTGGAAGAGATGCAACCGTCTGGTAGTGGTCATGTGTAGTCATGTGTAACCTGAAGCCGGCCAAAAATGCGCGGCGTCACCTCGGAGGGAGGCTATGGTCATGTGCGCATCTATCATGTGCGCATCTACACCGGAAAAAAAGTGGAAGTGCTCAGTCCGCCCGGACCTGGTTCACTGCGAGGGCTATCGAAGATCTTTGAGTCGTGCGCCCCGGGATCTGAAGACCAACGGCGAACTGAACTGGTTGCCTGCTACAAGGGCGC

Full Affymetrix probeset data:

Annotations for 1626469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720