Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626470_at:

>probe:Drosophila_2:1626470_at:220:557; Interrogation_Position=1776; Antisense; GGACTGCGCATTGCTGCTCTGAGCA
>probe:Drosophila_2:1626470_at:219:105; Interrogation_Position=1817; Antisense; AGAAATACTTGGACACCGTTCGGTG
>probe:Drosophila_2:1626470_at:85:133; Interrogation_Position=1831; Antisense; ACCGTTCGGTGAGGATGCAAGTTCT
>probe:Drosophila_2:1626470_at:655:215; Interrogation_Position=1893; Antisense; AAGTTTGCTGGCACGGACACTGAAC
>probe:Drosophila_2:1626470_at:273:397; Interrogation_Position=1908; Antisense; GACACTGAACGCAAACACGCTCGTG
>probe:Drosophila_2:1626470_at:308:659; Interrogation_Position=1941; Antisense; TAAGCATTTACAGAGCCAAGAGCCC
>probe:Drosophila_2:1626470_at:535:123; Interrogation_Position=1961; Antisense; AGCCCAGCACTGATTTTGTTTTTTA
>probe:Drosophila_2:1626470_at:55:721; Interrogation_Position=2006; Antisense; TTGTTTTCTCTAAGTGTACCACCTA
>probe:Drosophila_2:1626470_at:403:455; Interrogation_Position=2021; Antisense; GTACCACCTAATGCTAAAGACCCTA
>probe:Drosophila_2:1626470_at:255:323; Interrogation_Position=2033; Antisense; GCTAAAGACCCTAAGTTGTTTCATT
>probe:Drosophila_2:1626470_at:628:537; Interrogation_Position=2119; Antisense; GGTAGTATCAACTCACAGCGAAAAT
>probe:Drosophila_2:1626470_at:247:29; Interrogation_Position=2214; Antisense; ATACGATCCGACGTCTAAATAGTCT
>probe:Drosophila_2:1626470_at:262:137; Interrogation_Position=2282; Antisense; ACGAAATACAGTTTGCGACCACGCC
>probe:Drosophila_2:1626470_at:639:321; Interrogation_Position=2304; Antisense; GCCCTCTATAGAACAACCACTCAAT

Paste this into a BLAST search page for me
GGACTGCGCATTGCTGCTCTGAGCAAGAAATACTTGGACACCGTTCGGTGACCGTTCGGTGAGGATGCAAGTTCTAAGTTTGCTGGCACGGACACTGAACGACACTGAACGCAAACACGCTCGTGTAAGCATTTACAGAGCCAAGAGCCCAGCCCAGCACTGATTTTGTTTTTTATTGTTTTCTCTAAGTGTACCACCTAGTACCACCTAATGCTAAAGACCCTAGCTAAAGACCCTAAGTTGTTTCATTGGTAGTATCAACTCACAGCGAAAATATACGATCCGACGTCTAAATAGTCTACGAAATACAGTTTGCGACCACGCCGCCCTCTATAGAACAACCACTCAAT

Full Affymetrix probeset data:

Annotations for 1626470_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime