FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626472_at:

>probe:Drosophila_2:1626472_at:275:23; Interrogation_Position=1088; Antisense; ATATGTCGTCGGCACAACAATCGGC
>probe:Drosophila_2:1626472_at:213:593; Interrogation_Position=587; Antisense; TGGTGTGGCTGCCATTAGGCATCAT
>probe:Drosophila_2:1626472_at:569:569; Interrogation_Position=604; Antisense; GGCATCATGCTTATCTGCTACATAG
>probe:Drosophila_2:1626472_at:329:423; Interrogation_Position=676; Antisense; GAGAACCCGCTGACAGTGAGCTATA
>probe:Drosophila_2:1626472_at:491:121; Interrogation_Position=706; Antisense; AGCGTGGCCAAGACACTGTTCATTG
>probe:Drosophila_2:1626472_at:542:711; Interrogation_Position=724; Antisense; TTCATTGTGGTCGTTGTCTTTGCAG
>probe:Drosophila_2:1626472_at:316:143; Interrogation_Position=756; Antisense; ACTGCCCTTTACAATCCTGGTTGTA
>probe:Drosophila_2:1626472_at:469:667; Interrogation_Position=793; Antisense; TACTTCGGTGAAGATGTCTCTGTCA
>probe:Drosophila_2:1626472_at:649:617; Interrogation_Position=827; Antisense; TGCAGCTATTCTGGTACATATCACA
>probe:Drosophila_2:1626472_at:23:689; Interrogation_Position=853; Antisense; TATTTGATGTTTCTGAACGCCGCCG
>probe:Drosophila_2:1626472_at:650:233; Interrogation_Position=880; Antisense; AATCCGCTGATCTATGGCTTCAACA
>probe:Drosophila_2:1626472_at:497:161; Interrogation_Position=932; Antisense; AAATTTCTTGGGTTCGCCGATGGCG
>probe:Drosophila_2:1626472_at:711:575; Interrogation_Position=953; Antisense; GGCGAGACGCCACCCAAATGAAGAA
>probe:Drosophila_2:1626472_at:423:109; Interrogation_Position=974; Antisense; AGAAGTTTTCTCGATCACCAGACCA

Paste this into a BLAST search page for me
ATATGTCGTCGGCACAACAATCGGCTGGTGTGGCTGCCATTAGGCATCATGGCATCATGCTTATCTGCTACATAGGAGAACCCGCTGACAGTGAGCTATAAGCGTGGCCAAGACACTGTTCATTGTTCATTGTGGTCGTTGTCTTTGCAGACTGCCCTTTACAATCCTGGTTGTATACTTCGGTGAAGATGTCTCTGTCATGCAGCTATTCTGGTACATATCACATATTTGATGTTTCTGAACGCCGCCGAATCCGCTGATCTATGGCTTCAACAAAATTTCTTGGGTTCGCCGATGGCGGGCGAGACGCCACCCAAATGAAGAAAGAAGTTTTCTCGATCACCAGACCA

Full Affymetrix probeset data:

Annotations for 1626472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720