FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626475_at:

>probe:Drosophila_2:1626475_at:335:65; Interrogation_Position=2410; Antisense; ATGGAGTACGAGTGCTCCCGCGGAC
>probe:Drosophila_2:1626475_at:621:329; Interrogation_Position=2429; Antisense; GCGGACACCGGTTCATGATGTGCGC
>probe:Drosophila_2:1626475_at:14:45; Interrogation_Position=2485; Antisense; ATCGAACGCGAAACCTGCAGCATGG
>probe:Drosophila_2:1626475_at:631:589; Interrogation_Position=2507; Antisense; TGGTAGTCCACAACAACATGCCGCT
>probe:Drosophila_2:1626475_at:208:119; Interrogation_Position=2576; Antisense; AGCTGATGCGCATCCATGTGGTGAC
>probe:Drosophila_2:1626475_at:26:227; Interrogation_Position=2605; Antisense; AAGGCGCCGGTCAACATCATCGTGG
>probe:Drosophila_2:1626475_at:156:37; Interrogation_Position=2620; Antisense; ATCATCGTGGATCCCAAGGTGTGCG
>probe:Drosophila_2:1626475_at:157:373; Interrogation_Position=2648; Antisense; GAAGGTACACCTTCACCATGGGCAG
>probe:Drosophila_2:1626475_at:557:643; Interrogation_Position=2729; Antisense; TCTACCAGGGTGACGATGTGCTCAT
>probe:Drosophila_2:1626475_at:203:683; Interrogation_Position=2800; Antisense; TATCTACTGCCTGGGATGTTCGGAG
>probe:Drosophila_2:1626475_at:519:531; Interrogation_Position=2826; Antisense; GGTGGAGACGGATCCCACACTGGAT
>probe:Drosophila_2:1626475_at:132:359; Interrogation_Position=2857; Antisense; GAACCTGACAAGATGGGCGCTTCTG
>probe:Drosophila_2:1626475_at:387:203; Interrogation_Position=2934; Antisense; AACCATTATGATCCTGTACCTCTTA
>probe:Drosophila_2:1626475_at:588:485; Interrogation_Position=2949; Antisense; GTACCTCTTACCAGAGTTCCACTGT

Paste this into a BLAST search page for me
ATGGAGTACGAGTGCTCCCGCGGACGCGGACACCGGTTCATGATGTGCGCATCGAACGCGAAACCTGCAGCATGGTGGTAGTCCACAACAACATGCCGCTAGCTGATGCGCATCCATGTGGTGACAAGGCGCCGGTCAACATCATCGTGGATCATCGTGGATCCCAAGGTGTGCGGAAGGTACACCTTCACCATGGGCAGTCTACCAGGGTGACGATGTGCTCATTATCTACTGCCTGGGATGTTCGGAGGGTGGAGACGGATCCCACACTGGATGAACCTGACAAGATGGGCGCTTCTGAACCATTATGATCCTGTACCTCTTAGTACCTCTTACCAGAGTTCCACTGT

Full Affymetrix probeset data:

Annotations for 1626475_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720