FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626476_at:

>probe:Drosophila_2:1626476_at:551:223; Interrogation_Position=1006; Antisense; AAGGACACCTTTCTGGGTGCCAACA
>probe:Drosophila_2:1626476_at:611:505; Interrogation_Position=1022; Antisense; GTGCCAACACAACTGCCTTAGAGGA
>probe:Drosophila_2:1626476_at:444:435; Interrogation_Position=1042; Antisense; GAGGATGTAAAAACCCCATCGCCGT
>probe:Drosophila_2:1626476_at:640:393; Interrogation_Position=1074; Antisense; GAAAGTGCGCTTTATGAGCCCCAAG
>probe:Drosophila_2:1626476_at:494:103; Interrogation_Position=1100; Antisense; AGACGACCGATAACCTGTGCCGAAA
>probe:Drosophila_2:1626476_at:576:505; Interrogation_Position=1116; Antisense; GTGCCGAAAGCACAGTTCCTTCAAG
>probe:Drosophila_2:1626476_at:103:185; Interrogation_Position=1143; Antisense; AAAATGCAGCAGTTCGTACGCCGAT
>probe:Drosophila_2:1626476_at:505:651; Interrogation_Position=1169; Antisense; TCAAAAGTTGTGTGCGCTGTCGTCT
>probe:Drosophila_2:1626476_at:276:241; Interrogation_Position=1213; Antisense; AATAACACCGTGACGTAGCCACGTA
>probe:Drosophila_2:1626476_at:70:511; Interrogation_Position=1288; Antisense; GTGCACGCATATTTGACTAAGCCAT
>probe:Drosophila_2:1626476_at:689:379; Interrogation_Position=904; Antisense; GAAGCCAGCAGACAGCCAGCTGCAA
>probe:Drosophila_2:1626476_at:112:93; Interrogation_Position=936; Antisense; AGTTGCTGTGCCCATGGTTGAGATC
>probe:Drosophila_2:1626476_at:382:97; Interrogation_Position=956; Antisense; AGATCAACATGAACGACCCGCAGCT
>probe:Drosophila_2:1626476_at:641:119; Interrogation_Position=977; Antisense; AGCTGAGTCATCTGCGCAACGACTA

Paste this into a BLAST search page for me
AAGGACACCTTTCTGGGTGCCAACAGTGCCAACACAACTGCCTTAGAGGAGAGGATGTAAAAACCCCATCGCCGTGAAAGTGCGCTTTATGAGCCCCAAGAGACGACCGATAACCTGTGCCGAAAGTGCCGAAAGCACAGTTCCTTCAAGAAAATGCAGCAGTTCGTACGCCGATTCAAAAGTTGTGTGCGCTGTCGTCTAATAACACCGTGACGTAGCCACGTAGTGCACGCATATTTGACTAAGCCATGAAGCCAGCAGACAGCCAGCTGCAAAGTTGCTGTGCCCATGGTTGAGATCAGATCAACATGAACGACCCGCAGCTAGCTGAGTCATCTGCGCAACGACTA

Full Affymetrix probeset data:

Annotations for 1626476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720