FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626477_at:

>probe:Drosophila_2:1626477_at:223:329; Interrogation_Position=1030; Antisense; GCGGCGGCCCGGGATAAATCAAAGA
>probe:Drosophila_2:1626477_at:60:213; Interrogation_Position=1051; Antisense; AAGACTTCAAACACATCACTACCGC
>probe:Drosophila_2:1626477_at:398:215; Interrogation_Position=1112; Antisense; AAGATTACGTGAAGCTGCAGCCCCT
>probe:Drosophila_2:1626477_at:694:295; Interrogation_Position=1167; Antisense; CGAGCATCATCTGCCCACAATTTGA
>probe:Drosophila_2:1626477_at:573:117; Interrogation_Position=638; Antisense; AGCTCTATCTGATCCGCAAGACGCT
>probe:Drosophila_2:1626477_at:151:323; Interrogation_Position=678; Antisense; GCGCCACATCCAGATCTTTGGACAG
>probe:Drosophila_2:1626477_at:227:697; Interrogation_Position=712; Antisense; TTTAAGGGCATCACGCTGCCAGTGC
>probe:Drosophila_2:1626477_at:558:213; Interrogation_Position=763; Antisense; AAGATGCCGGCCAAGTCGCAGCAGA
>probe:Drosophila_2:1626477_at:250:109; Interrogation_Position=785; Antisense; AGAATCCCCTGACCATTGACTTTCT
>probe:Drosophila_2:1626477_at:692:403; Interrogation_Position=802; Antisense; GACTTTCTCAAGAAGTGCCTGGACA
>probe:Drosophila_2:1626477_at:426:505; Interrogation_Position=816; Antisense; GTGCCTGGACAAGGATCCGACCAAG
>probe:Drosophila_2:1626477_at:552:591; Interrogation_Position=844; Antisense; TGGTCCTGCGAGAAGCTCACAAAGC
>probe:Drosophila_2:1626477_at:7:173; Interrogation_Position=864; Antisense; AAAGCACTCCTACTTCGATGACTAC
>probe:Drosophila_2:1626477_at:587:195; Interrogation_Position=905; Antisense; AACTGGAGCACGTCAACAGCCTGGA

Paste this into a BLAST search page for me
GCGGCGGCCCGGGATAAATCAAAGAAAGACTTCAAACACATCACTACCGCAAGATTACGTGAAGCTGCAGCCCCTCGAGCATCATCTGCCCACAATTTGAAGCTCTATCTGATCCGCAAGACGCTGCGCCACATCCAGATCTTTGGACAGTTTAAGGGCATCACGCTGCCAGTGCAAGATGCCGGCCAAGTCGCAGCAGAAGAATCCCCTGACCATTGACTTTCTGACTTTCTCAAGAAGTGCCTGGACAGTGCCTGGACAAGGATCCGACCAAGTGGTCCTGCGAGAAGCTCACAAAGCAAAGCACTCCTACTTCGATGACTACAACTGGAGCACGTCAACAGCCTGGA

Full Affymetrix probeset data:

Annotations for 1626477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720