Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626478_at:

>probe:Drosophila_2:1626478_at:225:289; Interrogation_Position=4218; Antisense; CGGATTAGTCTCCTTGATACTGGTA
>probe:Drosophila_2:1626478_at:279:591; Interrogation_Position=4238; Antisense; TGGTATCGTTATATCCTGGACTCTG
>probe:Drosophila_2:1626478_at:681:585; Interrogation_Position=4254; Antisense; TGGACTCTGGAGGATTCGAGCCCGC
>probe:Drosophila_2:1626478_at:574:487; Interrogation_Position=4298; Antisense; GTACCAGATCTATGCATACCAGGAG
>probe:Drosophila_2:1626478_at:180:409; Interrogation_Position=4322; Antisense; GACGATTAACGAGCCCAGCACGGAT
>probe:Drosophila_2:1626478_at:392:443; Interrogation_Position=4365; Antisense; GATGTCAGCGCTATGTTGCTGCCAA
>probe:Drosophila_2:1626478_at:178:129; Interrogation_Position=4420; Antisense; ACCAGAGGTATTACTTCGCTGTGCG
>probe:Drosophila_2:1626478_at:226:25; Interrogation_Position=4453; Antisense; ATAGTCACGAACGATTCGGGCCGTT
>probe:Drosophila_2:1626478_at:197:647; Interrogation_Position=4477; Antisense; TCAGTGTTCCCAAGACCTGGTCGTA
>probe:Drosophila_2:1626478_at:612:499; Interrogation_Position=4511; Antisense; GTCTGTTCTCTTCCTTAGATTCTAG
>probe:Drosophila_2:1626478_at:125:725; Interrogation_Position=4563; Antisense; TTGTCCTTGGTAATCCGTTCTCGAA
>probe:Drosophila_2:1626478_at:492:293; Interrogation_Position=4578; Antisense; CGTTCTCGAAACTAGCCGGAATTAT
>probe:Drosophila_2:1626478_at:450:475; Interrogation_Position=4663; Antisense; GTTATGCCAAGCAGTCAATCCACTG
>probe:Drosophila_2:1626478_at:625:189; Interrogation_Position=4713; Antisense; AACATTGTATTTCATTCTCACTAGG

Paste this into a BLAST search page for me
CGGATTAGTCTCCTTGATACTGGTATGGTATCGTTATATCCTGGACTCTGTGGACTCTGGAGGATTCGAGCCCGCGTACCAGATCTATGCATACCAGGAGGACGATTAACGAGCCCAGCACGGATGATGTCAGCGCTATGTTGCTGCCAAACCAGAGGTATTACTTCGCTGTGCGATAGTCACGAACGATTCGGGCCGTTTCAGTGTTCCCAAGACCTGGTCGTAGTCTGTTCTCTTCCTTAGATTCTAGTTGTCCTTGGTAATCCGTTCTCGAACGTTCTCGAAACTAGCCGGAATTATGTTATGCCAAGCAGTCAATCCACTGAACATTGTATTTCATTCTCACTAGG

Full Affymetrix probeset data:

Annotations for 1626478_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime